Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
GGA1-golgi associated, gamma adaptin ear containing, ARF binding protein 1 Gene
PTXBC029388
New product
Data sheet of GGA1-golgi associated, gamma adaptin ear containing, ARF binding protein 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GGA1-golgi associated, gamma adaptin ear containing, ARF binding protein 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC029388 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GGA1 |
| Origin species: | Human |
| Product name: | GGA1-golgi associated, gamma adaptin ear containing, ARF binding protein 1 Gene |
| Size: | 2ug |
| Accessions: | BC029388 |
| Gene id: | 26088 |
| Gene description: | golgi associated, gamma adaptin ear containing, ARF binding protein 1 |
| Synonyms: | ADP-ribosylation factor-binding protein GGA1; ADP-ribosylation factor binding protein 1; gamma-adaptin related protein 1; golgi-localized, gamma ear-containing, ARF-binding protein 1; golgi associated, gamma adaptin ear containing, ARF binding protein 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagcccgcgatggagccggagactctggaggcgcgaatcaatagagccacgaaccccctgaacaaggagctcgactgggccagcatcaacggcttctgcgagcagctcaacgaggactttgaggggcctccactcgccacccggctgctggcccacaagatccagtccccacaggagtgggaggcgatccaggccttgacggtgagaaggggagaggccaccatccgtcccccgccatgtgacgacaccaagggaggccaagactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - solute carrier family 2 (facilitated glucose transporter), member 2 - golgi associated, gamma adaptin ear containing, ARF binding protein 1 - chemokine (C-C motif) ligand 18 (pulmonary and activation-regulated) - family with sequence similarity 62 (C2 domain containing), member A |