TMLHE-trimethyllysine hydroxylase, epsilon Gene View larger

TMLHE-trimethyllysine hydroxylase, epsilon Gene

PTXBC025269

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TMLHE-trimethyllysine hydroxylase, epsilon Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TMLHE-trimethyllysine hydroxylase, epsilon Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC025269
Product type: DNA & cDNA
Ncbi symbol: TMLHE
Origin species: Human
Product name: TMLHE-trimethyllysine hydroxylase, epsilon Gene
Size: 2ug
Accessions: BC025269
Gene id: 55217
Gene description: trimethyllysine hydroxylase, epsilon
Synonyms: AUTSX6; BBOX2; TMLD; TMLH; TMLHED; XAP130; trimethyllysine dioxygenase, mitochondrial; TML hydroxylase; TML-alpha-ketoglutarate dioxygenase; butyrobetaine (gamma), 2-oxoglutarate dioxygenase (gamma-butyrobetaine hydroxylase) 2; epsilon-trimethyllysine 2-oxoglutarate dioxygenase; epsilon-trimethyllysine hydroxylase; trimethyllysine hydroxylase, epsilon
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtggtaccacagattgtcccacctacacagcaggcttcaggacttgctgaagggaggagtcatatatccggcccttccacagcccaacttcaaaagcttacttcctttagctgtccattggcaccatacagcctccaagtctctgacttgtgcttggcagcaacatgaagatcattttgagctgaaatatgctaataccgtgatgcgctttgattacgtctggcttcgagaccactgccgctcagcatcgtgctacaactctaagactcaccagcgcagcctggatactgccagtgtggatttatgtatcaagccaaagaccattcgtctggatgagaccacactctttttcacttggccagatggtcatgtgactaaatatgatttgaattggctggtgaaaaacagctatgaagggcagaaacaaaaagtcatccagcctagaatactatggaatgctgaaatctaccagcaagcccaagttccatcggtagattgccagagcttcttagaaaccaacgagggactgaagaagtttctgcaaaactttctgctctatggaattgcattcgtagaaaatgtccctcccactcaagagcacacagagaagttggcagaaaggatcagcttaatcagagaaaccatttatgggaggatgtggtatttcacttcagacttctccagaggtgacactgcgtacaccaagctagctctggatcggcacactgacactacctattttcaagagccctgtggcattcaagtgtttcattgtcttaaacatgaaggaactggtggcaggacactgctagtagatggattctatgcagcagaacaggtacttcaaaaggcacctgaggaatttgaactcctcagtaaagtgccattgaagcatgaatatattgaagatgttggagaatgtcacaaccacatgattgggattgggccagtcttaaatatctacccatggaataaagagctgtatttgatcagattattcaaagaaaaacaaaacacggtcaacaggcagtggaactcctcactccaatgtgatattcctgagagaatattgacttatcgtcacttcgtctctgggacaagtattgaacataggggaagccttatataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - glucosamine-6-phosphate deaminase 1
- chromosome X open reading frame 38
- zinc finger, DHHC-type containing 7
- secretoglobin, family 3A, member 2

Buy TMLHE-trimethyllysine hydroxylase, epsilon Gene now

Add to cart