Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of SCGB3A2-secretoglobin, family 3A, member 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SCGB3A2-secretoglobin, family 3A, member 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC024232 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SCGB3A2 |
| Origin species: | Human |
| Product name: | SCGB3A2-secretoglobin, family 3A, member 2 Gene |
| Size: | 2ug |
| Accessions: | BC024232 |
| Gene id: | 117156 |
| Gene description: | secretoglobin, family 3A, member 2 |
| Synonyms: | LU103; PNSP1; UGRP1; pnSP-1; secretoglobin family 3A member 2; pneumo secretory protein 1; uteroglobin-related protein 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaagctggtaactatcttcctgctggtgaccatcagcctttgtagttactctgctactgccttcctcatcaacaaagtgccccttcctgttgacaagttggcacctttacctctggacaacattcttccctttatggatccattaaagcttcttctgaaaactctgggcatttctgttgagcaccttgtggaggggctaaggaagtgtgtaaatgagctgggaccagaggcttctgaagctgtgaagaaactgctggaggcgctatcacacttggtgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - mitochondrial ribosomal protein L36 - zinc finger CCCH-type containing 15 - chromosome 5 open reading frame 23 - glucosidase, beta, acid 3 (cytosolic) |