Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of GBA3-glucosidase, beta, acid 3 (cytosolic) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GBA3-glucosidase, beta, acid 3 (cytosolic) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC029362 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GBA3 |
| Origin species: | Human |
| Product name: | GBA3-glucosidase, beta, acid 3 (cytosolic) Gene |
| Size: | 2ug |
| Accessions: | BC029362 |
| Gene id: | 57733 |
| Gene description: | glucosidase, beta, acid 3 (cytosolic) |
| Synonyms: | CBG; CBGL1; GLUC; KLRP; cytosolic beta-glucosidase; cytosolic beta-glucosidase-like protein 1; glucosidase, beta, acid 3 (cytosolic); klotho-related protein; glucosylceramidase beta 3 (gene/pseudogene) |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctttccctgcaggatttggatgggcggcagccactgcagcttatcaagtagaaggaggctgggatgcagatggaaaaggcccttgtgtctgggacacatttactcatcagggaggagagagagttttcaagaaccagactggcgatgtagcttgtggcagctacactctgtgggaggaagatttgaaatgtatcaaacagcttggattgactcattaccgcttctctctttcctggtcacgtctgttacctgatgggacgacaggtttcatcaaccagaaagctatccaacttgataaagtcaatcttcaagtatattgtgcatggtctcttctggataactttgagtggaaccagggatacagcagccggtttggtctcttccacgttgattttgaagacccagctagaccccgagtcccttacacatcggccaaggaatatgccaagatcatccgaaacaatggccttgaagcacatctgtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome 7 open reading frame 11 - basic transcription factor 3-like 4 - chromosome 1 open reading frame 54 - chromosome 1 open reading frame 64 |