Cart 2 Product Products 508,40 € (empty)
-
1 x C5orf23-ch...113,40 € -
No products
To be determined Shipping
508,40 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 2 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 508,40 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 508,40 €
Data sheet of C1orf54-chromosome 1 open reading frame 54 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about C1orf54-chromosome 1 open reading frame 54 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC017761 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | C1orf54 |
| Origin species: | Human |
| Product name: | C1orf54-chromosome 1 open reading frame 54 Gene |
| Size: | 2ug |
| Accessions: | BC017761 |
| Gene id: | 79630 |
| Gene description: | chromosome 1 open reading frame 54 |
| Synonyms: | uncharacterized protein C1orf54; chromosome 1 open reading frame 54 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggatgtcctctttgtagccatctttgctgtgccacttatcctgggacaagaatatgaggatgaagaaagactgggagaggatgaatattatcaggtggtctattattatacagtcacccccagttatgatgactttagtgcagatttcaccattgattactccatatttgagtcagaggacaggctgaacaggttggataaggacataacagaagcaatagagactaccattagtcttgaaacagcacgtgcagaccatccgaagcctgtaactgtgaaaccagtaacaacggaacctagcccagatctgaacgatgccgtgtccagtttgcgaagtcctattcccctcctcctgtcgtgtgcctttgttcaggtggggatgtatttcatgtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome 1 open reading frame 64 - chromosome 11 open reading frame 1 - mitochondrial ribosomal protein L30 - mitochondrial ribosomal protein L35 |