Product successfully added to your shopping cart
Quantity
Total
There are 3 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 812,60 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 812,60 €
Data sheet of GNPDA1-glucosamine-6-phosphate deaminase 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GNPDA1-glucosamine-6-phosphate deaminase 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC020769 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GNPDA1 |
| Origin species: | Human |
| Product name: | GNPDA1-glucosamine-6-phosphate deaminase 1 Gene |
| Size: | 2ug |
| Accessions: | BC020769 |
| Gene id: | 10007 |
| Gene description: | glucosamine-6-phosphate deaminase 1 |
| Synonyms: | GNP1; GNPDA; GNPI; GPI; HLN; glucosamine-6-phosphate isomerase 1; GNPDA 1; glcN6P deaminase 1; oscillin; glucosamine-6-phosphate deaminase 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaagctcatcatcctggagcactattctcaggcgagcgagtgggcggctaaatacatcaggaaccgtatcatccagtttaacccagggccagagaagtacttcaccctggggctccccactgggagtaccccacttggctgctacaagaagctgattgaatactataagaatggggacctgtcctttaaatatgtgaagaccttcaacatggatgagtacgtgggccttcctcgagaccacccggagagttaccactccttcatgtggaacaacttcttcaagcacattgacatccacccagaaaacacccacattctggatgggaatgcagtcgacctacaggcagaatgtgatgcctttgaagagaagatcaaggctgcaggtgggatcgagctatttgttggaggcatcggccctgatggacacattgccttcaacgagccaggctccagtctggtgtccaggacccgtgtgaagacgctggccatggataccatcctggccaatgctaggttcttcgatggagaactcaccaaggtgcccaccatggccttgacggtgggggtgggcactgtcatggatgctagagaggtgatgatccttatcacaggtgctcacaaggcatttgctctgtacaaggccatcgaggagggagtgaaccacatgtggaccgtgtctgccttccagcagcatccccgcaccgtgtttgtgtgtgacgaggatgccaccttggagctgaaagtgaagactgtcaagtatttcaaaggtttaatgcttgttcataacaagttggtggaccccttgtacagtatcaaagagaaagaaactgagaaaagccaatcttcgaagaaaccatacagcgattag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome X open reading frame 38 - zinc finger, DHHC-type containing 7 - secretoglobin, family 3A, member 2 - mitochondrial ribosomal protein L36 |