GNPDA1-glucosamine-6-phosphate deaminase 1 Gene View larger

GNPDA1-glucosamine-6-phosphate deaminase 1 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GNPDA1-glucosamine-6-phosphate deaminase 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about GNPDA1-glucosamine-6-phosphate deaminase 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC020769
Product type: DNA & cDNA
Ncbi symbol: GNPDA1
Origin species: Human
Product name: GNPDA1-glucosamine-6-phosphate deaminase 1 Gene
Size: 2ug
Accessions: BC020769
Gene id: 10007
Gene description: glucosamine-6-phosphate deaminase 1
Synonyms: GNP1; GNPDA; GNPI; GPI; HLN; glucosamine-6-phosphate isomerase 1; GNPDA 1; glcN6P deaminase 1; oscillin; glucosamine-6-phosphate deaminase 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagctcatcatcctggagcactattctcaggcgagcgagtgggcggctaaatacatcaggaaccgtatcatccagtttaacccagggccagagaagtacttcaccctggggctccccactgggagtaccccacttggctgctacaagaagctgattgaatactataagaatggggacctgtcctttaaatatgtgaagaccttcaacatggatgagtacgtgggccttcctcgagaccacccggagagttaccactccttcatgtggaacaacttcttcaagcacattgacatccacccagaaaacacccacattctggatgggaatgcagtcgacctacaggcagaatgtgatgcctttgaagagaagatcaaggctgcaggtgggatcgagctatttgttggaggcatcggccctgatggacacattgccttcaacgagccaggctccagtctggtgtccaggacccgtgtgaagacgctggccatggataccatcctggccaatgctaggttcttcgatggagaactcaccaaggtgcccaccatggccttgacggtgggggtgggcactgtcatggatgctagagaggtgatgatccttatcacaggtgctcacaaggcatttgctctgtacaaggccatcgaggagggagtgaaccacatgtggaccgtgtctgccttccagcagcatccccgcaccgtgtttgtgtgtgacgaggatgccaccttggagctgaaagtgaagactgtcaagtatttcaaaggtttaatgcttgttcataacaagttggtggaccccttgtacagtatcaaagagaaagaaactgagaaaagccaatcttcgaagaaaccatacagcgattag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome X open reading frame 38
- zinc finger, DHHC-type containing 7
- secretoglobin, family 3A, member 2
- mitochondrial ribosomal protein L36

Buy GNPDA1-glucosamine-6-phosphate deaminase 1 Gene now

Add to cart