ZDHHC7-zinc finger, DHHC-type containing 7 Gene View larger

ZDHHC7-zinc finger, DHHC-type containing 7 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ZDHHC7-zinc finger, DHHC-type containing 7 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ZDHHC7-zinc finger, DHHC-type containing 7 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC018772
Product type: DNA & cDNA
Ncbi symbol: ZDHHC7
Origin species: Human
Product name: ZDHHC7-zinc finger, DHHC-type containing 7 Gene
Size: 2ug
Accessions: BC018772
Gene id: 55625
Gene description: zinc finger, DHHC-type containing 7
Synonyms: palmitoyltransferase ZDHHC7; DHHC7; SERZ-B; SERZ1; ZNF370; DHHC-7; Sertoli cell gene with zinc finger domain-β zinc finger DHHC domain-containing protein 7; zinc finger protein 370; zinc finger, DHHC domain containing 7; zinc finger DHHC-type containing 7
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcagccatcaggacacaggctccgggacgtcgagcatcatcctctcctggctgaaaatgacaactatgactcttcatcgtcctcctcctccgaggctgacgtggctgaccgggtctggttcatccgtgacggctgcggcatgatctgtgctgtcatgacgtggcttctggtcgcctatgcagacttcgtggtgactttcgtcatgctgctgccttccaaagacttctggtactctgtggtcaacggggtcatctttaactgcttggccgtgcttgccctgtcatcccacctgagaaccatgctcaccgaccctgaaaaatccagtgactgccgaccatctgcctgcacagtgaaaactgggctggacccaacccttgtgggcatttgtggtgagggaaccgagtctgtgcaaagcctcctgcttggggcagtacccaaaggaaacgctacgaaagaatacatggagagcttgcagctgaagcccggggaagtcatctacaagtgccccaagtgctgctgtattaaacccgagcgcgcccaccactgcagtatttgcaaaagatgtattcggaaaatggatcatcactgcccgtgggtgaacaattgtgtaggagaaaagaatcaaagattttttgtgctcttcactatgtatatagctctgtcttcagtccatgctctgatcctttgtggatttcagttcatctcctgtgtccgagggcagtggactgaatgcagtgatttttcacctccgataactgtaatcctgttgatcttcctgtgccttgagggtcttctgtttttcactttcactgcagttatgtttggcacccaaatccactccatatgcaacgacgagacggagatcgagcgattgaaaagtgagaagcccacatgggagcggaggctgcgatgggaagggatgaagtccgtctttggggggcccccctcactcctctggatgaatccctttgtgggcttccgatttaggcgactgcccacgagacccagaaaaggcggcccggagttctcagtgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - secretoglobin, family 3A, member 2
- mitochondrial ribosomal protein L36
- zinc finger CCCH-type containing 15
- chromosome 5 open reading frame 23

Buy ZDHHC7-zinc finger, DHHC-type containing 7 Gene now

Add to cart