CXorf38-chromosome X open reading frame 38 Gene View larger

CXorf38-chromosome X open reading frame 38 Gene

PTXBC025334

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CXorf38-chromosome X open reading frame 38 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CXorf38-chromosome X open reading frame 38 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC025334
Product type: DNA & cDNA
Ncbi symbol: CXorf38
Origin species: Human
Product name: CXorf38-chromosome X open reading frame 38 Gene
Size: 2ug
Accessions: BC025334
Gene id: 159013
Gene description: chromosome X open reading frame 38
Synonyms: uncharacterized protein CXorf38; chromosome X open reading frame 38
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtgctgtcggagctagcggcgcgcctcaactgcgccgagtacaagaactgggtgaaggcgggccactgcctgctactgctgcgcagctgcctgcagggtttcgtcggccgcgaggtgctctccttccaccgcggcctactcgccgcagcccccggcctggggccccgcgccgtctgccgcggcggctcacggtgcagccctcgcgcccgccagtttcagcctcagtgtcaggtgtgcgctgaatggaaaagggagattttgagacatcatgtcaacagaaatggagatgtgcactggggaaactgccggccgggccgctggcccgtggacgcctgggaggtggccaaggccttcatgccccgaggactagcagacaaacaaggacctgaggaatgtgatgcagttgctcttttaagtctcatcaactcctgcgatcacttcgtggttgatcgaaagaaagtcacagaggtaattaaatgtcgtaatgagatcatgcactcttcagagatgaaagtatcttctacgtggcttcgagattttcagatgaagatccaaaattttctgaatgaattcaagaacatcccagagattgtggcagtatactccagaatagaacagctgttgacgtctgactgggctgttcacatccccgaggaagatcagcgagatgggtgtgaatgtgaaatgggaacttacctgagtgagagccaagtcaatgaaatagaaatgcagttactaaaggagaaacttcaagagatatatcttcaagcagaagaacaagaggtgttgcctgaagagctctcaaatcgactggaagtggtgaaggaatttctgagaaacaatgaggatcttagaaatggccttacagaagatatgcagaagctagacagcctctgtctacatcaaaaactggattcacaggaacctgggagacaaacacctgacaggaaggcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - zinc finger, DHHC-type containing 7
- secretoglobin, family 3A, member 2
- mitochondrial ribosomal protein L36
- zinc finger CCCH-type containing 15

Buy CXorf38-chromosome X open reading frame 38 Gene now

Add to cart