TNFRSF11B-tumor necrosis factor receptor superfamily, member 11b Gene View larger

TNFRSF11B-tumor necrosis factor receptor superfamily, member 11b Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TNFRSF11B-tumor necrosis factor receptor superfamily, member 11b Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TNFRSF11B-tumor necrosis factor receptor superfamily, member 11b Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC030155
Product type: DNA & cDNA
Ncbi symbol: TNFRSF11B
Origin species: Human
Product name: TNFRSF11B-tumor necrosis factor receptor superfamily, member 11b Gene
Size: 2ug
Accessions: BC030155
Gene id: 4982
Gene description: tumor necrosis factor receptor superfamily, member 11b
Synonyms: OCIF; OPG; PDB5; TR1; tumor necrosis factor receptor superfamily member 11B; osteoclastogenesis inhibitory factor; tumor necrosis factor receptor superfamily, member 11b; TNF receptor superfamily member 11b
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaacaacttgctgtgctgcgcgctcgtgtttctggacatctccattaagtggaccacccaggaaacgtttcctccaaagtaccttcattatgacgaagaaacctctcatcagctgttgtgtgacaaatgtcctcctggtacctacctaaaacaacactgtacagcaaagtggaagaccgtgtgcgccccttgccctgaccactactacacagacagctggcacaccagtgacgagtgtctatactgcagccccgtgtgcaaggagctgcagtacgtcaagcaggagtgcaatcgcacccacaaccgcgtgtgcgaatgcaaggaagggcgctaccttgagatagagttctgcttgaaacataggagctgccctcctggatttggagtggtgcaagctggaaccccagagcgaaatacagtttgcaaaagatgtccagatgggttcttctcaaatgagacgtcatctaaagcaccctgtagaaaacacacaaattgcagtgtctttggtctcctgctaactcagaaaggaaatgcaacacacgacaacatatgttccggaaacagtgaatcaactcaaaaatgtggaatagatgttaccctgtgtgaggaggcattcttcaggtttgctgttcctacaaagtttacgcctaactggcttagtgtcttggtagacaatttgcctggcaccaaagtaaacgcagagagtgtagagaggataaaacggcaacacagctcacaagaacagactttccagctgctgaagttatggaaacatcaaaacaaagaccaagatatagtcaagaagatcatccaagatattgacctctgtgaaaacagcgtgcagcggcacattggacatgctaacctcaccttcgagcagcttcgtagcttgatggaaagcttaccgggaaagaaagtgggagcagaagacattgaaaaaacaataaaggcatgcaaacccagtgaccagatcctgaagctgctcagtttgtggcgaataaaaaatggcgaccaagacaccttgaagggcctaatgcacgcactaaagcactcaaagacgtaccactttcccaaaactgtcactcagagtctaaagaagaccatcaggttccttcacagcttcacaatgtacaaattgtatcagaagttatttttagaaatgataggtaaccaggtccaatcagtaaaaataagctgcttataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - solute carrier family 31 (copper transporters), member 2
- LysM, putative peptidoglycan-binding, domain containing 3
- hydroxysteroid (17-beta) dehydrogenase 6 homolog (mouse)
- StAR-related lipid transfer (START) domain containing 10

Buy TNFRSF11B-tumor necrosis factor receptor superfamily, member 11b Gene now

Add to cart