Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
LYSMD3-LysM, putative peptidoglycan-binding, domain containing 3 Gene
PTXBC058027
New product
Data sheet of LYSMD3-LysM, putative peptidoglycan-binding, domain containing 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about LYSMD3-LysM, putative peptidoglycan-binding, domain containing 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC058027 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LYSMD3 |
| Origin species: | Human |
| Product name: | LYSMD3-LysM, putative peptidoglycan-binding, domain containing 3 Gene |
| Size: | 2ug |
| Accessions: | BC058027 |
| Gene id: | 116068 |
| Gene description: | LysM, putative peptidoglycan-binding, domain containing 3 |
| Synonyms: | lysM and putative peptidoglycan-binding domain-containing protein 3; LysM, putative peptidoglycan-binding, domain containing 3; LysM domain containing 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcagggaggcatcagaatcgtagttttcctcttccaggagttcagtcaagtggtcaagtacatgcatttggaaattgttcagacagtgatattttggaggaggatgctgaagtgtatgaacttcgatccagaggaaaagagaaagtccgaagaagtacatcaagagatagacttgacgacattatagtattaacaaaagatatacaagaaggagatacattaaatgcaatagcccttcagtactgttgtacggtctatcaaaattccagtaaaaaagttcagttccttgaccgaaacactttgtcctccaaaaggaagacagacttcacgtcattcatctgttcaatactcttccgaacaacaggaaattttgccagctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - hydroxysteroid (17-beta) dehydrogenase 6 homolog (mouse) - StAR-related lipid transfer (START) domain containing 10 - signal transducer and activator of transcription 2, 113kDa - LysM, putative peptidoglycan-binding, domain containing 1 |