Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
STARD10-StAR-related lipid transfer (START) domain containing 10 Gene
PTXBC007919
New product
Data sheet of STARD10-StAR-related lipid transfer (START) domain containing 10 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about STARD10-StAR-related lipid transfer (START) domain containing 10 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC007919 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | STARD10 |
| Origin species: | Human |
| Product name: | STARD10-StAR-related lipid transfer (START) domain containing 10 Gene |
| Size: | 2ug |
| Accessions: | BC007919 |
| Gene id: | 10809 |
| Gene description: | StAR-related lipid transfer (START) domain containing 10 |
| Synonyms: | CGI-52; NY-CO-28; PCTP2; SDCCAG28; PCTP-like protein; PCTP-L; START domain containing 10; START domain-containing protein 10; StAR-related lipid transfer (START) domain containing 10; antigen NY-CO-28; serologically defined colon cancer antigen 28; stAR-related lipid transfer protein 10; StAR related lipid transfer domain containing 10 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagaagctggcggcctctacagagccccaagggcctcggccggtcctgggccgtgagagtgtccaggtgcccgatgaccaagactttcgcagcttccggtcagagtgtgaggctgaggtgggctggaacctgacctatagcagggctggggtgtctgtctgggtgcaggctgtggagatggatcggacgctgcacaagatcaagtgccggatggagtgctgtgatgtgccagccgagacactctacgacgtcctacacgacattgagtaccgcaagaaatgggacagcaacgtcattgagacttttgacatcgcccgcttgacagtcaacgctgacgtgggctattactcctggaggtgtcccaagcccctgaagaaccgtgatgtcatcaccctccgctcctggctccccatgggcgctgattacatcattatgaactactcagtcaaacatcccaaatacccacctcggaaagacttggtccgagctgtgtccatccagacgggctacctcatccagagcacagggcccaagagctgcgtcatcacctacctggcccaggtggaccccaaaggctccttacccaagtgggtggtgaataaatcttctcagttcctggctcccaaggccatgaagaagatgtacaaggcgtgcctcaagtaccccgagtggaaacagaagcacctgcctcacttcaagccgtggctgcacccggagcagagcccgttgccgagcctggcgctgtcggagctgtcggtgcagcatgcggactcactggagaacatcgacgagagcgcggtggccgagagcagagaggagcggatgggcggcgcgggcggcgagggcagcgacgacgacacctcgctcacctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - signal transducer and activator of transcription 2, 113kDa - LysM, putative peptidoglycan-binding, domain containing 1 - inturned planar cell polarity effector homolog (Drosophila) - myosin, light chain 6, alkali, smooth muscle and non-muscle |