PTXBC071661
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC071661 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MYL6 |
| Origin species: | Human |
| Product name: | MYL6-myosin, light chain 6, alkali, smooth muscle and non-muscle Gene |
| Size: | 2ug |
| Accessions: | BC071661 |
| Gene id: | 4637 |
| Gene description: | myosin, light chain 6, alkali, smooth muscle and non-muscle |
| Synonyms: | ESMLC; LC17; LC17-GI; LC17-NM; LC17A; LC17B; MLC-3; MLC1SM; MLC3NM; MLC3SM; myosin light polypeptide 6; 17 kDa myosin light chain; myosin light chain A3; myosin light chain alkali 3; myosin, light chain 6, alkali, smooth muscle and non-muscle; myosin, light polypeptide 6, alkali, smooth muscle and non-muscle; myosin light chain 6 |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtgtgacttcaccgaagaccagaccgcagagttcaaggaggccttccagctgtttgaccgaacaggtgatggcaagatcctgtacagccagtgtggggatgtgatgagggccctgggccagaaccctaccaacgccgaggtgctcaaggtcctggggaaccccaagagtgatgagatgaatgtgaaggtgctggactttgagcactttctgcccatgctgcagacagtggccaagaacaaggaccagggcacctatgaggattatgtcgaaggacttcgggtgtttgacaaggaaggaaatggcaccgtcatgggtgctgaaatccggcatgttcttgtcacactgggtgagaagatgacagaggaagaagtagagatgctggtggcagggcatgaggacagcaatggttgtatcaactatgaagagctcgtccgcatggtgctgaatggctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - signaling lymphocytic activation molecule family member 1 - regulatory factor X, 3 (influences HLA class II expression) - cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4) - ventricular zone expressed PH domain homolog 1 (zebrafish) |