VEPH1-ventricular zone expressed PH domain homolog 1 (zebrafish) Gene View larger

VEPH1-ventricular zone expressed PH domain homolog 1 (zebrafish) Gene

PTXBC057999

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of VEPH1-ventricular zone expressed PH domain homolog 1 (zebrafish) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about VEPH1-ventricular zone expressed PH domain homolog 1 (zebrafish) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC057999
Product type: DNA & cDNA
Ncbi symbol: VEPH1
Origin species: Human
Product name: VEPH1-ventricular zone expressed PH domain homolog 1 (zebrafish) Gene
Size: 2ug
Accessions: BC057999
Gene id: 79674
Gene description: ventricular zone expressed PH domain homolog 1 (zebrafish)
Synonyms: MELT; VEPH; ventricular zone-expressed PH domain-containing protein homolog 1; protein melted; ventricular zone expressed PH domain homolog 1; ventricular zone expressed PH domain containing 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcatcaactgttcagactggttttgggacaaaaagatctttcacgagctggggacctcttctccttagatgactctgagattgaagacagccttacagaagctttggagcaaattaagataattagctcatcttcagattaccaaaccaataacaatgaccaggcagtagttgaaatctgtatcacaagaatcacaacagccatcagagagaccgagtccattgaaaagcatgcaaaggcccttgtggggctctgggactcctgcttggaacataacctgagaccctttgggaaagacgaagacactcctcatgcaaaaatcgcatctgatatcatgagttgcattttacagaattacaaccgacccccagtgatggcattagccatccccattgcagtgaaattcctccacagaggcaacaaggaactgtgcaggaatatgtctaactacctgtctctggctgcaattaccaaggcagatctcctggctgatcacacggaagttatagtaaagagcatactccaaggtatggtgcgaaagttgagcttggggacatgttttgggagatatttaaaagtattttcatcaagcatttatggtttgtgggaagcaagacctagagtattagaagcaaattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - RNA binding motif protein, Y-linked, family 1, member A1
- proteasome (prosome, macropain) 26S subunit, non-ATPase, 3
- haloacid dehalogenase-like hydrolase domain containing 1A
- ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E1

Buy VEPH1-ventricular zone expressed PH domain homolog 1 (zebrafish) Gene now

Add to cart