Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
ATP6V1E1-ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E1 Gene
PTXBC004443
New product
Data sheet of ATP6V1E1-ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ATP6V1E1-ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC004443 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ATP6V1E1 |
| Origin species: | Human |
| Product name: | ATP6V1E1-ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E1 Gene |
| Size: | 2ug |
| Accessions: | BC004443 |
| Gene id: | 529 |
| Gene description: | ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E1 |
| Synonyms: | ATP6E; ATP6E2; ATP6V1E; P31; Vma4; V-type proton ATPase subunit E 1; ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E1; H(+)-transporting two-sector ATPase, 31kDa subunit; H+-transporting ATP synthase chain E, vacuolar; V-ATPase 31 kDa subunit; V-ATPase subunit E 1; V-ATPase, subunit E; vacuolar proton pump subunit E 1; ATPase H+ transporting V1 subunit E1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctctcagcgatgctgacgtgcaaaagcagataaagcatatgatggctttcattgaacaagaagccaatgagaaagcagaagaaatagatgcaaaggcagaagaagagttcaacatagagaaaggtcggcttgtgcaaacccaaagactaaagattatggaatattatgagaagaaagagaaacagattgagcagcagaagaaaattcagatgtccaatttgatgaatcaagcgagactcaaagtcctcagagcaagagatgaccttatcacagacctactaaatgaagcaaaacagagactcagcaaggtggtaaaagatacaaccaggtaccaagtgctgctggatggactggttctccagggtttgtaccagttgctggagccccgaatgattgttcgttgcaggaaacaagatttccctctggtaaaggctgcagtgcagaaggcaattcctatgtacaaaattgccaccaaaaacgatgttgatgtccaaattgaccaggagtcctacctgcctgaagacatagctggtggagttgagatctataatggagatcgtaaaataaaggtttccaacaccctggaaagccggctggatctcatagcccagcagatgatgccagaagtccggggagccttgtttggtgcaaatgccaacaggaagtttttggactaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - IMP4, U3 small nucleolar ribonucleoprotein, homolog (yeast) - ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G3 - protein phosphatase 1, regulatory (inhibitor) subunit 11 - 5-hydroxytryptamine (serotonin) receptor 3 family member D |