Cart 1 Product Products 102,78 € (empty)
No products
To be determined Shipping
102,78 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 102,78 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 102,78 €
View larger 
HTR3D-5-hydroxytryptamine (serotonin) receptor 3 family member D Gene
PTXBC101090
New product
Data sheet of HTR3D-5-hydroxytryptamine (serotonin) receptor 3 family member D Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HTR3D-5-hydroxytryptamine (serotonin) receptor 3 family member D Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC101090 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HTR3D |
| Origin species: | Human |
| Product name: | HTR3D-5-hydroxytryptamine (serotonin) receptor 3 family member D Gene |
| Size: | 2ug |
| Accessions: | BC101090 |
| Gene id: | 200909 |
| Gene description: | 5-hydroxytryptamine (serotonin) receptor 3 family member D |
| Synonyms: | 5HT3D; 5-hydroxytryptamine receptor 3D; 5-hydroxytryptamine (serotonin) receptor 3 family member D; 5-hydroxytryptamine (serotonin) receptor 3D, ionotropic; 5-hydroxytryptamine receptor 3 subunit D; serotonin 5-HT-3D receptor; serotonin receptor 3D |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggtggccatcaggcgcaggtgcaggcccagcccctacgtggtaaactttctggtgcccagtggcattctgattgccatcgatgccctcagtttctacctgccactggaaagtgggaattgtgccccattcaagatgactgttctgctgggctacagcgtcttcctgctcatgatgaatgacttgctcccagccactagcacttcatcacatgcttcactagtacgtcctcatccatcaagagaccaaaagcgaggtgtctacttcgccctgtgcctgtccctgatggtgggcagcctgctggagaccatcttcatcacccacctgctgcacgtggccaccacccagcccctacctctgcctcggtggctccactccctgctgctgcactgcaccggccaagggagatgctgtcccactgcgccccagaagggaaataagggcccgggtctcacccccacccacctgcccggtgtgaaggagccagaggtatcagcagggcagatgccaggccctggggaggcagagctgacagggggctcagaatggacaagggcccagcgggaacacgaggcccagaagcagcactcggtggagctgtgggtgcagttcagccacgcgatggacgccctgctcttccgcctctacctgctcttcatggcctcctccatcatcaccgtcatatgcctctggaacacctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - regulatory factor X-associated ankyrin-containing protein - asparagine-linked glycosylation 13 homolog (S. cerevisiae) - protein phosphatase 1, regulatory (inhibitor) subunit 3A - proteasome (prosome, macropain) 26S subunit, non-ATPase, 1 |