Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
RFXANK-regulatory factor X-associated ankyrin-containing protein Gene
PTXBC114563
New product
Data sheet of RFXANK-regulatory factor X-associated ankyrin-containing protein Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RFXANK-regulatory factor X-associated ankyrin-containing protein Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC114563 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RFXANK |
| Origin species: | Human |
| Product name: | RFXANK-regulatory factor X-associated ankyrin-containing protein Gene |
| Size: | 2ug |
| Accessions: | BC114563 |
| Gene id: | 8625 |
| Gene description: | regulatory factor X-associated ankyrin-containing protein |
| Synonyms: | DNA-binding protein RFXANK; ANKRA1; BLS; F14150_1; RFX-B; RFX-Bdelta4; ankyrin repeat family A protein 1; ankyrin repeat-containing regulatory factor X-associated protein; regulatory factor X subunit B; regulatory factor X associated ankyrin containing protein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagcttacccagcctgcagaagacctcatccagacccagcagacccctgcctcagaacttggggaccctgaagaccccggagaggaggctgcagatggctcagacactgtggtcctcagtctctttccctgcacccctgagcctgtgaatcctgaaccggatgccagtgtttcctctccacaggcaggcagctccctgaagcactccaccactctcaccaaccggcagcgagggaacgaggtgtcagctctgccggccaccctagactccctgtccatccaccagctcgcagcacagggggagctggaccagctgaaggagcatttgcggaaaggtgacaacctcgtcaacaagccagacgagcgcggcttcacccccctcatctgggcctccgcctttggagagattgagaccgttcgcttcctgctggagtggggtgccgacccccacatcctggcaaaagagcgagagagcgccctgtcgctggccagcacaggcggctacacagacattgtggggctgctgctggagcgtgacgtggacatcaacatctatgattggaatggagggacgccactgctgtacgctgtgcgcgggaaccacgtgaaatgcgttgaggccttgctggcccgaggcgctgacctcaccaccgaagccgactctggctacaccccgatggaccttgccgtggccctgggataccggaaagtgcaacaggtgatcgagaaccacatcctcaagctcttccagagcaacctggtgcccgctgaccctgagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - asparagine-linked glycosylation 13 homolog (S. cerevisiae) - protein phosphatase 1, regulatory (inhibitor) subunit 3A - proteasome (prosome, macropain) 26S subunit, non-ATPase, 1 - inturned planar cell polarity effector homolog (Drosophila) |