Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
IMP4-IMP4, U3 small nucleolar ribonucleoprotein, homolog (yeast) Gene
PTXBC010042
New product
Data sheet of IMP4-IMP4, U3 small nucleolar ribonucleoprotein, homolog (yeast) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about IMP4-IMP4, U3 small nucleolar ribonucleoprotein, homolog (yeast) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC010042 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | IMP4 |
| Origin species: | Human |
| Product name: | IMP4-IMP4, U3 small nucleolar ribonucleoprotein, homolog (yeast) Gene |
| Size: | 2ug |
| Accessions: | BC010042 |
| Gene id: | 92856 |
| Gene description: | IMP4, U3 small nucleolar ribonucleoprotein, homolog (yeast) |
| Synonyms: | IMP4 homolog, U3 small nucleolar ribonucleoprotein; U3 snoRNP protein IMP4; IMP4, U3 small nucleolar ribonucleoprotein, homolog; IMP4, U3 small nucleolar ribonucleoprotein; U3 small nucleolar ribonucleoprotein protein IMP4; BXDC4; U3 snoRNP protein 4 homolog; brix domain-containing protein 4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctgcgccgcgaggcccgcctgcgccgcgagtacctgtaccgcaaggcccgggaggaggcgcagcgctcagcccaggagaggaaggagcggctgcggcgcgcgctggaagaaaaccgcctgattcccactgagttacgccgagaggctctggccttacaggggtccctggagtttgatgatgctggaggtgaaggtgtgaccagccacgtggatgatgaataccgatgggcaggagtcgaggatcccaaggttatgatcactacctcccgagaccccagttcccgcctcaagatgtttgcaaaggagctgaagctggtgttcccgggcgcccagcgaatgaaccgaggtcgacatgaagtgggggcactggtgcgagcctgcaaagccaacggcgtcaccgatctgctggtcgttcacgagcatcggggcacacctgtggggctcatcgtcagccacctgccctttggtcctactgcctacttcacgctgtgcaatgtggtcatgcggcatgacatcccagacctgggcaccatgtcggaggccaagccccacctcatcacacacggcttctcctcccgcctgggcaagcgggtctctgacatcctccgatacctatttcccgtgcccaaagatgacagccaccgggtcatcaccttcgcaaaccaggacgactacatatcattccggcaccatgtgtataagaagacagaccaccgcaacgtggagctcactgaggtcgggccccgctttgagctgaagctgtacatgatccgtctgggcacgctggagcaggaggccacagcagacgtggagtggcgctggcacccttacaccaataccgcacgcaagagagtcttcctgagcaccgagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G3 - protein phosphatase 1, regulatory (inhibitor) subunit 11 - 5-hydroxytryptamine (serotonin) receptor 3 family member D - regulatory factor X-associated ankyrin-containing protein |