Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
ATP6V1G3-ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G3 Gene
PTXBC101130
New product
Data sheet of ATP6V1G3-ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ATP6V1G3-ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC101130 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ATP6V1G3 |
| Origin species: | Human |
| Product name: | ATP6V1G3-ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G3 Gene |
| Size: | 2ug |
| Accessions: | BC101130 |
| Gene id: | 127124 |
| Gene description: | ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G3 |
| Synonyms: | ATP6G3; Vma10; V-type proton ATPase subunit G 3; ATPase, H+ transporting, lysosomal (vacuolar proton pump) subunit G3; ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G3; V-ATPase 13 kDa subunit 3; V-ATPase G subunit 3; V-ATPase G3 subunit; V-ATPase subunit G 3; vacuolar ATP synthase subunit G 3; vacuolar proton pump G subunit 3; vacuolar proton pump subunit G 3; vacuolar proton pump, subunit G3; ATPase H+ transporting V1 subunit G3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgacaagccagtctcaggggatccaccagcttcttcaggcagaaaaacgggccaaggacaagctagaggaagccaagaagagaaaaggaaagcgattgaagcaagccaaggaggaagcaatggtagaaattgaccagtacagaatgcagagagataaagagtttcgactaaaacaatctaagataatgggctctcagaataatctctcagatgaaatagaagaacaaacactagggaagatacaagaacttaatggacactacaataagtatatggaaagtgtgatgaaccagctcttgagcatggtctgtgacatgaaaccagaaatccatgtgaactacagagccaccaactaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - protein phosphatase 1, regulatory (inhibitor) subunit 11 - 5-hydroxytryptamine (serotonin) receptor 3 family member D - regulatory factor X-associated ankyrin-containing protein - asparagine-linked glycosylation 13 homolog (S. cerevisiae) |