Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SLAMF1-signaling lymphocytic activation molecule family member 1 Gene
PTXBC067847
New product
Data sheet of SLAMF1-signaling lymphocytic activation molecule family member 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SLAMF1-signaling lymphocytic activation molecule family member 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC067847 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SLAMF1 |
| Origin species: | Human |
| Product name: | SLAMF1-signaling lymphocytic activation molecule family member 1 Gene |
| Size: | 2ug |
| Accessions: | BC067847 |
| Gene id: | 6504 |
| Gene description: | signaling lymphocytic activation molecule family member 1 |
| Synonyms: | CDw150; SLAM; signaling lymphocytic activation molecule; IPO-3; SLAM family member 1; signaling lymphocytic activation molecule family member 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggatcccaaggggctcctctccttgaccttcgtgctgtttctctccctggcttttggggcaagctacggaacaggtgggcgcatgatgaactgcccaaagattctccggcagttgggaagcaaagtgctgctgcccctgacatatgaaaggataaataagagcatgaacaaaagcatccacattgtcgtcacaatggcaaaatcactggagaacagtgtcgagaacaaaatagtgtctcttgatccatccgaagcaggccctccacgttatctaggagatcgctacaagttttatctggagaatctcaccctggggatacgggaaagcaggaaggaggatgagggatggtaccttatgaccctggagaaaaatgtttcagttcagcgcttttgcctgcagttgaggctttatggtaataatggcggcttccccagtccacactaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - regulatory factor X, 3 (influences HLA class II expression) - cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4) - ventricular zone expressed PH domain homolog 1 (zebrafish) - RNA binding motif protein, Y-linked, family 1, member A1 |