Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
CDKN2C-cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4) Gene
PTXBC000598
New product
Data sheet of CDKN2C-cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CDKN2C-cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000598 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CDKN2C |
| Origin species: | Human |
| Product name: | CDKN2C-cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4) Gene |
| Size: | 2ug |
| Accessions: | BC000598 |
| Gene id: | 1031 |
| Gene description: | cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4) |
| Synonyms: | INK4C; p18; p18-INK4C; cyclin-dependent kinase 4 inhibitor C; CDK6 inhibitor p18; cyclin-dependent inhibitor; cyclin-dependent kinase 6 inhibitor p18; cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4); p18-INK6; cyclin dependent kinase inhibitor 2C |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccgagccttgggggaacgagttggcgtccgcagctgccaggggggacctagagcaacttactagtttgttgcaaaataatgtaaacgtcaatgcacaaaatggatttggaaggactgcgctgcaggttatgaaacttggaaatcccgagattgccaggagactgctacttagaggtgctaatcccgatttgaaagaccgaactggtttcgctgtcattcatgatgcggccagagcaggtttcctggacactttacagactttgctggagtttcaagctgatgttaacatcgaggataatgaagggaacctgcccttgcacttggctgccaaagaaggccacctccgggtggtggagttcctggtgaagcacacggccagcaatgtggggcatcggaaccataagggggacaccgcctgtgatttggccaggctctatgggaggaatgaggttgttagcctgatgcaggcaaacggggctgggggagccacaaatcttcaataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ventricular zone expressed PH domain homolog 1 (zebrafish) - RNA binding motif protein, Y-linked, family 1, member A1 - proteasome (prosome, macropain) 26S subunit, non-ATPase, 3 - haloacid dehalogenase-like hydrolase domain containing 1A |