CDKN2C-cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4) Gene View larger

CDKN2C-cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4) Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CDKN2C-cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CDKN2C-cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000598
Product type: DNA & cDNA
Ncbi symbol: CDKN2C
Origin species: Human
Product name: CDKN2C-cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4) Gene
Size: 2ug
Accessions: BC000598
Gene id: 1031
Gene description: cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4)
Synonyms: INK4C; p18; p18-INK4C; cyclin-dependent kinase 4 inhibitor C; CDK6 inhibitor p18; cyclin-dependent inhibitor; cyclin-dependent kinase 6 inhibitor p18; cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4); p18-INK6; cyclin dependent kinase inhibitor 2C
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccgagccttgggggaacgagttggcgtccgcagctgccaggggggacctagagcaacttactagtttgttgcaaaataatgtaaacgtcaatgcacaaaatggatttggaaggactgcgctgcaggttatgaaacttggaaatcccgagattgccaggagactgctacttagaggtgctaatcccgatttgaaagaccgaactggtttcgctgtcattcatgatgcggccagagcaggtttcctggacactttacagactttgctggagtttcaagctgatgttaacatcgaggataatgaagggaacctgcccttgcacttggctgccaaagaaggccacctccgggtggtggagttcctggtgaagcacacggccagcaatgtggggcatcggaaccataagggggacaccgcctgtgatttggccaggctctatgggaggaatgaggttgttagcctgatgcaggcaaacggggctgggggagccacaaatcttcaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ventricular zone expressed PH domain homolog 1 (zebrafish)
- RNA binding motif protein, Y-linked, family 1, member A1
- proteasome (prosome, macropain) 26S subunit, non-ATPase, 3
- haloacid dehalogenase-like hydrolase domain containing 1A

Buy CDKN2C-cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4) Gene now

Add to cart