C21orf2-chromosome 21 open reading frame 2 Gene View larger

C21orf2-chromosome 21 open reading frame 2 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C21orf2-chromosome 21 open reading frame 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C21orf2-chromosome 21 open reading frame 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC031300
Product type: DNA & cDNA
Ncbi symbol: C21orf2
Origin species: Human
Product name: C21orf2-chromosome 21 open reading frame 2 Gene
Size: 2ug
Accessions: BC031300
Gene id: 755
Gene description: chromosome 21 open reading frame 2
Synonyms: nuclear encoded mitochondrial protein C21orf2; protein C21orf2; LRRC76; YF5/A2; leucine rich repeat containing 76; leucine-rich repeat-containing protein 76; chromosome 21 open reading frame 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagctgacgcggaagatggttctgacccgggccaaggcctcggagctgcacagcgtgcgcaagctcaactgctggggcagccgcctcacagatatctccatttgccaggagatgcccagcctggaggtgatcacgctcagtgtcaacagcatctccaccctggagcctgtgagccggtgccagcgcctgagtgagctgtacctgcggaggaaccgcatccccagcctggctgagctcttctacctgaaggggctgccgcgtctgcgggtgctgtggctggccgagaacccgtgctgcggcaccagcccccaccgctaccgcatgaccgtgctgcgcaccctgccgcgcctacagaagctggacaaccaggctgtgacggaggaggagctgtcccgtgcactgagtgagggagaggagatcactgcggccccagagagagagggcacaggccacggcggccccaagctatgctgcacactgagctccctcagctccgctgctgagactggccgggacccgctggacagcgaggaggaggcaaccggcgcccaggatgaacgtggcctgaagccgccttcccggggccagtttccttccctctcagccagggatgcctcgagcagccacaggggcagggtgagtggcgggccgctaggggccgcggctgcctctgcccactgcacccactgcacagaaaccgtggggagggagcatggagcctcacagggccccgtggggagggagcatggagcctcacagggccttgaagagctgtgccccagggggagctgcgtgtgcgggtctgtgaatgcgcacacacgtgtaacacgtgccccgcacggagccgtcctggcccctcagcctctcctgctgtcctggtctgtggaatgtgggcccgggccctgctgggctgagggcaacaggagtcacgtggaagaggtgccacacacgcgtccacaggcggggctcctctgctcagattctccgagtgtgccgaacgtcctgactgccatcctgctgctgctgcgggagctggatgcagaggggctggaggccgtgcagcagactgtgggcagccggctgcaggccctgcgtggggaagaggtgcaggagcacgccgagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - trimethyllysine hydroxylase, epsilon
- glucosamine-6-phosphate deaminase 1
- chromosome X open reading frame 38
- zinc finger, DHHC-type containing 7

Buy C21orf2-chromosome 21 open reading frame 2 Gene now

Add to cart