MRPL19-mitochondrial ribosomal protein L19 Gene View larger

MRPL19-mitochondrial ribosomal protein L19 Gene

PTXBC030144

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MRPL19-mitochondrial ribosomal protein L19 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MRPL19-mitochondrial ribosomal protein L19 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC030144
Product type: DNA & cDNA
Ncbi symbol: MRPL19
Origin species: Human
Product name: MRPL19-mitochondrial ribosomal protein L19 Gene
Size: 2ug
Accessions: BC030144
Gene id: 9801
Gene description: mitochondrial ribosomal protein L19
Synonyms: L19mt; MRP-L15; MRP-L19; MRPL15; RLX1; RPML15; 39S ribosomal protein L19, mitochondrial; 39S ribosomal protein L15, mitochondrial; L15mt; mitochondrial ribosomal protein L19
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggcctgcattgcagcggggcactgggctgcaatgggcctaggccggagtttccaagccgccaggactctgctccccccgccggcctctatcgcctgcagggtccacgcggggcctgtccggcagcagagcactgggccttccgagcccggtgcgttccaaccgccgccgaaaccggtcatcgtggacaagcaccgccccgtggaaccggaacgcaggttcttgagtcctgaattcattcctcgaaggggaagaacagatcctctgaaatttcaaatagaaagaaaagatatgttagaaaggagaaaagtactccacattccagagttctatgttggaagtattcttcgtgttactacagctgacccatatgccagtggaaaaatcagccagtttctggggatttgcattcagagatcaggaagaggacttggagctactttcatccttaggaatgttatcgaaggacaaggtgtcgagatttgctttgaactttataatcctcgggtccaggagattcaggtggtcaaattagagaaacggctggatgatagcttgctatacttacgagatgcccttcctgaatatagcacttttgatgtgaatatgaagccagtagtacaagagcctaaccaaaaagttcctgttaatgagctgaaagtaaaaatgaagcctaagccctggtctaaacgctgggaacgtccaaattttaatattaaaggaatcagatttgatctttgtttaactgaacagcaaatgaaagaagctcagaagtggaatcagccatggcttgaatttgatatgatgagggaatatgatacttcaaaaattgaagctgcaatatggaaggaaattgaagcgtcgaaaaggtcttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 21 open reading frame 2
- trimethyllysine hydroxylase, epsilon
- glucosamine-6-phosphate deaminase 1
- chromosome X open reading frame 38

Buy MRPL19-mitochondrial ribosomal protein L19 Gene now

Add to cart