Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PPP2R3C-protein phosphatase 2 (formerly 2A), regulatory subunit B'', gamma Gene
PTXBC063438
New product
Data sheet of PPP2R3C-protein phosphatase 2 (formerly 2A), regulatory subunit B'', gamma Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PPP2R3C-protein phosphatase 2 (formerly 2A), regulatory subunit B'', gamma Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC063438 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PPP2R3C |
| Origin species: | Human |
| Product name: | PPP2R3C-protein phosphatase 2 (formerly 2A), regulatory subunit B'', gamma Gene |
| Size: | 2ug |
| Accessions: | BC063438 |
| Gene id: | 55012 |
| Gene description: | protein phosphatase 2 (formerly 2A), regulatory subunit B'', gamma |
| Synonyms: | C14orf10; G4-1; G5pr; serine/threonine-protein phosphatase 2A regulatory subunit B'' subunit gamma; protein phosphatase 2 (formerly 2A), regulatory subunit B''; protein phosphatase 2, regulatory subunit B'', gamma; protein phosphatase subunit G5PR; rhabdomyosarcoma antigen MU-RMS-40.6A; rhabdomyosarcoma antigen Mu-RMS-40.6C; protein phosphatase 2 regulatory subunit B''gamma |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgattggagaggaagcgatgatcaattacgaaaactttttgaaggttggtgaaaaggctggagcaaagtgcaagcaatttttcacagcaaaagtctttgctaaactccttcatacagattcatatggaagaatttccatcatgcagttctttaattatgtcatgagaaaagtttggcttcatcaaacaagaataggactcagtttatatgatgtcgctgggcaggggtaccttcgggaatctgatttagaaaactacatattggaacttatccctacgttgccacaattagatggtctggaaaaatctttctactccttttatgtttgtacagcagttaggaagttcttcttctttttagatcctttaagaacaggaaagataaaaattcaagatattttagcatgcagcttcctagatgatttattggagctaagggatgaggaactgtccaaggagagtcaagaaacaaattggttttctgctccttctgccctaagagtttatggccagtacttgaatcttgataaagatcacaatggcatgctcagtaaagaagaactctcacgctatggaacagctaccatgaccaatgtcttcttagaccgtgttttccaggagtgtctcacttatgatggagaaatggactataagacctacttggactttgtccttgcattagaaaacagaaaggaacctgcagctctacaatatattttcaaactgcttgatattgagaacaaaggatacctgaatgtcttttcacttaattatttctttagggccatacaggaactaatgaaaatccatggacaagatcctgtttcatttcaagatgtcaaggatgaaatctttgacatggtaaaaccaaaggatcctttgaaaatctctcttcaggatttaatcaacagtaatcaaggagacacagtaaccaccattctaatcgatttgaatggcttctggacttacgagaacagagaggctcttgttgcaaatgacagtgaaaactctgcagaccttgatgatacatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - solute carrier family 4, sodium bicarbonate cotransporter, member 4 - golgi associated, gamma adaptin ear containing, ARF binding protein 1 - solute carrier family 2 (facilitated glucose transporter), member 2 - golgi associated, gamma adaptin ear containing, ARF binding protein 1 |