C16orf65-chromosome 16 open reading frame 65 Gene View larger

C16orf65-chromosome 16 open reading frame 65 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C16orf65-chromosome 16 open reading frame 65 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C16orf65-chromosome 16 open reading frame 65 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC039562
Product type: DNA & cDNA
Ncbi symbol: C16orf65
Origin species: Human
Product name: C16orf65-chromosome 16 open reading frame 65 Gene
Size: 2ug
Accessions: BC039562
Gene id: 255762
Gene description: chromosome 16 open reading frame 65
Synonyms: PDZ domain-containing protein C16orf65; C16orf65; PDZ domain-containing protein 9; PDZ domain containing 9
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcagaaggtgaagaggaaggaggtgatgttctgattagtgttggccatgccaatgtgttaggatatactcttcgagaatttttacagcttttgcaacatatcactattggaacagtgctacaaatcaaggtttaccgagattttattaacattcctgaagaatggcaagaaatatatgatttaatccctgaggccaaattcccagtaacaagcacaccaaagaaaattgagctggcaaaagatgaatctttcacaagcagtgatgataatgaaaatgtagatttagataaaagacttcaatattatagatatccgtggtcaactgtgcatcaccctgcaaggagaccaatatccatctccagagactggcatggatataagaagaagaaccatactattagtgtaggaaaagacattaattgtgacgtgatgattcacagagacgacaagaaagaagtgagggccccttctccatactggataatggtgaagcaagacaatgaaagctcttcctcctctacctcctctacctcagatgcattttggctggaagattgtgcccaagttgaagagggtaaagcccaactggtatcaaaggttggttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 11 open reading frame 53
- chromosome 12 open reading frame 10
- dishevelled, dsh homolog 1 (Drosophila)
- chromosome 22 open reading frame 30

Buy C16orf65-chromosome 16 open reading frame 65 Gene now

Add to cart