C22orf30-chromosome 22 open reading frame 30 Gene View larger

C22orf30-chromosome 22 open reading frame 30 Gene

PTXBC040859

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C22orf30-chromosome 22 open reading frame 30 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C22orf30-chromosome 22 open reading frame 30 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC040859
Product type: DNA & cDNA
Ncbi symbol: C22orf30
Origin species: Human
Product name: C22orf30-chromosome 22 open reading frame 30 Gene
Size: 2ug
Accessions: BC040859
Gene id: 253143
Gene description: chromosome 22 open reading frame 30
Synonyms: C22orf30; protein PRR14L; proline rich 14-like protein; proline rich 14 like
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcagaggctcttcatgacccagtttacacagggcctgaaagggttacggtctccagcctccatagcagacaaggtcttctgttctctgccctactcggtgggcagagtcctatccatttggagccagcatggtccttctgtctgctccttcgaaatctcttctcttcattcccctcactgcaagcggcaaccaagtctgggcaccacaagcagccacaccatgttaccatatgtgcctcttccaggcatggaagctacatataacaccagcggcagtcagacgaggctggagcctccattccctgccttggtaccaaagtcttgcttggtagcagaatcagctgtcagcaagctcctgctttcagcctctgagttccaggttcgtggattggatgagctggatggtgtgaaagcagcatgcccctgcccacagagcagccccccagaacagaaagaggctgagccagagaagaggccaaagaaagtctcacagattcgcatccggaaaaccattcctaggccagatcctaatcttacccccatgggccttcctcgacccaaaaggttaaagaagaaggagtttagtttagaagagatatataccaacaagaattataaatctcctcctgcaaacagggacctggattctagctgcccgagcactgacagcgaaaccgggcacttcctggtattcggatatgcgcagcgccaagcgcagccgcacccactgctggcctcacgccgtctgattggctgcagctctccggaggggcggggccatccgagaagctatccatattggaggaggctgctagtcctttgctggtacctgccgggctggagagcggggagggtcacgtggttaagactcgccacgtgggccgggcgcggtgactcaagcctgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - src kinase associated phosphoprotein 1
- zinc finger, DHHC-type containing 12
- chromosome 11 open reading frame 84
- chromosome 6 open reading frame 134

Buy C22orf30-chromosome 22 open reading frame 30 Gene now

Add to cart