C12orf10-chromosome 12 open reading frame 10 Gene View larger

C12orf10-chromosome 12 open reading frame 10 Gene

PTXBC051871

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C12orf10-chromosome 12 open reading frame 10 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C12orf10-chromosome 12 open reading frame 10 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC051871
Product type: DNA & cDNA
Ncbi symbol: C12orf10
Origin species: Human
Product name: C12orf10-chromosome 12 open reading frame 10 Gene
Size: 2ug
Accessions: BC051871
Gene id: 60314
Gene description: chromosome 12 open reading frame 10
Synonyms: Gamm1; MST024; MSTP024; MYG; MYG1; UPF0160 protein MYG1, mitochondrial; melanocyte proliferating gene 1; melanocyte related; chromosome 12 open reading frame 10
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggacaccgcttcctgcgcggcctcttaacgctgctgctgccgccgccacccctgtatacccggcaccgcatgctcggtccagagtccgtcccgcccccaaaacgatcccgcagcaaactcatggcaccgccccgaatcgggacgcacaatggcaccttccactgcgacgaggcactggcatgcgcactgcttcgcctcctgccggagtaccgggatgcagagattgtgcggacccgggatcccgaaaaactcgcttcctgtgacatcgtggtggacgtggggggcgagtacgaccctcggagacaccgatatgaccatcaccagaggtctttcacagagaccatgagctccctgtcccctgggaagccgtggcagaccaagctgagcagtgcgggactcatctatctgcacttcgggcacaagctgctggcccagttgctgggcactagtgaagaggacagcatggtgggcaccctctatgacaagatgtatgagaactttgtggaggaggtggatgctgtggacaatgggatctcccagtgggcagagggggagcctcgatatgcactgaccactaccctgagtgcacgagttgctcgacttaatcctacctggaaccaccccgaccaagacactgaggcagggttcaagcgtgcaatggatctggttcaagaggagtttctgcagagattagatttctaccaacacagctggctgccagcccgggccttggtggaagaggcccttgcccagcgattccaggtggacccaagtggagagattgtggaactggcgaaaggtgcatgtccctggaaggagcatctctaccacctggaatctgggctgtcccctccagtggccatcttctttgttatctacactgaccaggctggacagtggcgaatacagtgtgtgcccaaggagccccactcattccaaagccggctgcccctgccagagccatggcggggtcttcgggacgaggccctggaccaggtcagtgggatccctggctgcatcttcgtccatgcaagcggcttcattggcggtcaccgcacccgagagggtgccttgagcatggcccgtgccaccttggcccagcgctcatacctcccacaaatctcctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - dishevelled, dsh homolog 1 (Drosophila)
- chromosome 22 open reading frame 30
- src kinase associated phosphoprotein 1
- zinc finger, DHHC-type containing 12

Buy C12orf10-chromosome 12 open reading frame 10 Gene now

Add to cart