DVL1-dishevelled, dsh homolog 1 (Drosophila) Gene View larger

DVL1-dishevelled, dsh homolog 1 (Drosophila) Gene

PTXBC050454

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DVL1-dishevelled, dsh homolog 1 (Drosophila) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about DVL1-dishevelled, dsh homolog 1 (Drosophila) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC050454
Product type: DNA & cDNA
Ncbi symbol: DVL1
Origin species: Human
Product name: DVL1-dishevelled, dsh homolog 1 (Drosophila) Gene
Size: 2ug
Accessions: BC050454
Gene id: 1855
Gene description: dishevelled, dsh homolog 1 (Drosophila)
Synonyms: DRS2; DVL; DVL1L1; DVL1P1; segment polarity protein dishevelled homolog DVL-1; DSH homolog 1; dishevelled 1 (homologous to Drosophila dsh); dishevelled, dsh homolog 1; dishevelled-1; dishevelled segment polarity protein 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggagaccaagattatctaccacatggacgaggaggagacgccgtacctggtcaagctgcccgtggcccccgagcgcgtcacgctggccgacttcaagaacgtgctcagcaaccggcccgtgcacgcctacaaattcttctttaagtccatggaccaggacttcggggtggtgaaggaggagatctttgatgacaatgccaagcttccctgcttcaacggccgcgtggtctcctggctggtcctggctgagggtgctcactcggatgcggggtcccagggcacggacagccacacagacctgcccccgcctcttgagcggacaggcggcatcggggactcccggcccccctccttccacccgaatgtggccagcagccgtgacgggatggacaacgagacaggcacggagtccatggtcagtcaccggcgggagcgtgcccgacgccggaaccgcgaggaggccgcccggaccaatgggcacccaaggggagaccgacggcgggatgtggggctgcccccagacagcgcgtccaccgccctcagcagcgagcttgagtccagcagctttgtggactcggacgaggatggcagcacgagcaggctcagcagctccacggagcagagcacctcatccagactcacccggaagtacgccagcagcttgctgaagcacggcttcctgcggcacacggtcaacaagatcaccttctccgagcagtgctactacgtcttcggggatctctgcagcaatctcgccaccctgaacctcaacagtggctccagtgggacttcggatcaggacacgctggccccgctgccccacccggctgccccctggcctctgggtcagggctacccctaccagtacccgggacccccaccctgcttcccgcctgcctaccaggacccgggctttagctatggcagcggcagcaccgggagtcagcagagtgaagggagcaaaagcagtgggtccacccggagcagccgccgggccccgggccgtgagaaggagcgtcgggcggcgggagctgggggcagtggcagtgaatcggatcacacggcaccgagtggggtggggagcagctggcgagagcgtccggccggccagctcagccgtggcagcagcccacgcagtcaggcctcggctaccgccccggggctccccccgccccaccccacgaccaaggcctatacagtggtgggggggccacccgggggaccccctgtccgggagctggctgccgtccccccggaattgacaggcagccgccagtccttccagaaggctatggggaacccctgcgagttcttcgtggacatcatgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 22 open reading frame 30
- src kinase associated phosphoprotein 1
- zinc finger, DHHC-type containing 12
- chromosome 11 open reading frame 84

Buy DVL1-dishevelled, dsh homolog 1 (Drosophila) Gene now

Add to cart