Login to display prices
Login to display prices
C11orf53-chromosome 11 open reading frame 53 Gene View larger

C11orf53-chromosome 11 open reading frame 53 Gene

PTXBC039669

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C11orf53-chromosome 11 open reading frame 53 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C11orf53-chromosome 11 open reading frame 53 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC039669
Product type: DNA & cDNA
Ncbi symbol: C11orf53
Origin species: Human
Product name: C11orf53-chromosome 11 open reading frame 53 Gene
Size: 2ug
Accessions: BC039669
Gene id: 341032
Gene description: chromosome 11 open reading frame 53
Synonyms: uncharacterized protein C11orf53; chromosome 11 open reading frame 53
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccaggttcgccggtcacgtcaggttactacggtgtcagaagatctttcttatctgactcagacttccacaacagtaaacagttttcaaatgacgtctacacctccagcgtggggaagccgtttccctgtgagtcctccgcagggcagagccatgcggctctcctggagccctacttcccccaggagccctacggagactaccggcctccggcgctgacgcccaacgcgggctctctgttcagcgcctcgcccctaccgccgctcctgccaccgcccttccccggagacccagctcacttcctatttagggactcatgggagcagacgttgcctgacggtctcagccagcctgaccctgtgtctgccgatgccctgctgaccttgccacccagcacgagttgcctctcccagcttgagtccgggagcatcgcccagcacaggggctcaagctgggggtcatccctggctggggctcagtcatactcgctgcatgctctggaagatctgcaccacactccggggtaccctaccccgcctccttaccccttcacccctttcatgacggtgtcaaatgacctaccgcccaaggtggggccactctccccagatgaggaagcagacaccggttccctccatgacccttccccttgggtgaaagaagatgggagtattgcctgggggtcatatgaatgccgcagagcttattga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 12 open reading frame 10
- dishevelled, dsh homolog 1 (Drosophila)
- chromosome 22 open reading frame 30
- src kinase associated phosphoprotein 1