Login to display prices
Login to display prices
C17orf49-chromosome 17 open reading frame 49 Gene View larger

C17orf49-chromosome 17 open reading frame 49 Gene

PTXBC040036

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C17orf49-chromosome 17 open reading frame 49 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C17orf49-chromosome 17 open reading frame 49 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC040036
Product type: DNA & cDNA
Ncbi symbol: C17orf49
Origin species: Human
Product name: C17orf49-chromosome 17 open reading frame 49 Gene
Size: 2ug
Accessions: BC040036
Gene id: 124944
Gene description: chromosome 17 open reading frame 49
Synonyms: MLL1/MLL complex subunit C17orf49; BAP18; HEPIS; chromatin complexes subunit BAP18; BPTF-associated protein of 18 kDa; human embryo lung cellular protein interacting with SARS-CoV nsp-10; chromosome 17 open reading frame 49
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacgtcagcgtccacaaaggtcggagagatcttctcggcggccggcgccgccttcacgaagctcggggagctgacgatgcagctgcatcccgtggccgactcttctcctgcgggcgcgaagtggacggagacggaaatagagatgctgagggctgctgtgaagcgatttggggacgatcttaatcacatcagctgtgtcatcaaggaacggacagtggcccagataaaggccactgtgaaacgcaaggtatatgaagattctggcatcccccttccagctgagtcacccaagaaagggcccaagaaggtggcatctggtgtcttgtcacctcctccagctgcccctcctcccagcagctccagtgtccctgaggccgggggtccccccataaagaaacagaaggctgatgtgacactcagtgctctgaacgactccgatgccaacagtgacgtggtggatattgaagggctaggagaaactcctccagctaagaaactcaacttcgaccaggcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 16 open reading frame 65
- chromosome 11 open reading frame 53
- chromosome 12 open reading frame 10
- dishevelled, dsh homolog 1 (Drosophila)