Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of C17orf49-chromosome 17 open reading frame 49 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about C17orf49-chromosome 17 open reading frame 49 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC040036 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | C17orf49 |
| Origin species: | Human |
| Product name: | C17orf49-chromosome 17 open reading frame 49 Gene |
| Size: | 2ug |
| Accessions: | BC040036 |
| Gene id: | 124944 |
| Gene description: | chromosome 17 open reading frame 49 |
| Synonyms: | MLL1/MLL complex subunit C17orf49; BAP18; HEPIS; chromatin complexes subunit BAP18; BPTF-associated protein of 18 kDa; human embryo lung cellular protein interacting with SARS-CoV nsp-10; chromosome 17 open reading frame 49 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgacgtcagcgtccacaaaggtcggagagatcttctcggcggccggcgccgccttcacgaagctcggggagctgacgatgcagctgcatcccgtggccgactcttctcctgcgggcgcgaagtggacggagacggaaatagagatgctgagggctgctgtgaagcgatttggggacgatcttaatcacatcagctgtgtcatcaaggaacggacagtggcccagataaaggccactgtgaaacgcaaggtatatgaagattctggcatcccccttccagctgagtcacccaagaaagggcccaagaaggtggcatctggtgtcttgtcacctcctccagctgcccctcctcccagcagctccagtgtccctgaggccgggggtccccccataaagaaacagaaggctgatgtgacactcagtgctctgaacgactccgatgccaacagtgacgtggtggatattgaagggctaggagaaactcctccagctaagaaactcaacttcgaccaggcctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome 16 open reading frame 65 - chromosome 11 open reading frame 53 - chromosome 12 open reading frame 10 - dishevelled, dsh homolog 1 (Drosophila) |