C12orf72-chromosome 12 open reading frame 72 Gene View larger

C12orf72-chromosome 12 open reading frame 72 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C12orf72-chromosome 12 open reading frame 72 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C12orf72-chromosome 12 open reading frame 72 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC039535
Product type: DNA & cDNA
Ncbi symbol: C12orf72
Origin species: Human
Product name: C12orf72-chromosome 12 open reading frame 72 Gene
Size: 2ug
Accessions: BC039535
Gene id: 254013
Gene description: chromosome 12 open reading frame 72
Synonyms: C12orf72; ETFB-KMT; METTL20; electron transfer flavoprotein beta subunit lysine methyltransferase; ETFB lysine methyltransferase; methyltransferase like 20; methyltransferase-like protein 20; protein N-lysine methyltransferase METTL20
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctttgagtctaggttggaaagcacacaggaaccactgtggtctcctcttgcaggctctgcgaagcagtggtcttctcttgtttccctgtggccagtgtccctggagaggagctggaagctttttggaccctgagataaaggctttcctggaggagaacactgaagtcaccagcagtggtagcctcacccctgaaatccagttgcggcttttgacccccagatgcaaattctggtgggagagagctgacctgtggccccacagtgatccttactgggcaatctactggccaggaggccaagccctgtctaggtatcttttggataatcctgatgttgtcagaggaaaatctgtattagatcttgggagtggatgtggagctacagctattgctgctaagatgagtggggcatcaaggatcttggccaatgacatagaccctattgcaggaatggctattacactaaattgtgaattgaacagactgaatccttttcctattttaatccaaaacattttgaatttggaacaagataagtgggaccttgttgttcttggcgatatgttttatgatgaagaccttgcagatagtcttcatcagtggctgaagaagtgcttctggacctatagaactcgagtactgattggtgaccctgggcggccccagttcagtggacacagcattcagcatcacctgcacaaagtggtagaatattcacttttggagtctactaggcaggaaaacagtggactgacaacaagcacagtgtggggttttcagccttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 17 open reading frame 49
- chromosome 16 open reading frame 65
- chromosome 11 open reading frame 53
- chromosome 12 open reading frame 10

Buy C12orf72-chromosome 12 open reading frame 72 Gene now

Add to cart