Login to display prices
Login to display prices
C11orf74-chromosome 11 open reading frame 74 Gene View larger

C11orf74-chromosome 11 open reading frame 74 Gene

PTXBC051031

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C11orf74-chromosome 11 open reading frame 74 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C11orf74-chromosome 11 open reading frame 74 Gene

Proteogenix catalog: PTXBC051031
Ncbi symbol: C11orf74
Product name: C11orf74-chromosome 11 open reading frame 74 Gene
Size: 2ug
Accessions: BC051031
Gene id: 119710
Gene description: chromosome 11 open reading frame 74
Synonyms: uncharacterized protein C11orf74; HEPIS; NWC; chromosome 11 open reading frame 74
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtctgcccatatgtcaggattggaaataatggatgaagatcaattaatcaaagacgtcttggataaattccttaattgtcatgagcaaacatatgatgaagaatttctgaacacttttactcatctttcacaagaggatcatgtgtccaaaaggggagtgtttggaactgattcttcagaaaacatttttacctcagcaaaagttactcataaaaatgaagcagatgactaccatcttagaaataaaaccatctttcttcgtacttcatcacaatgtttggaagaacaggtagataatttcctagatttagaagatttggacatggatgaagagattaaaccccaaatgagtgaggatttgctgctgcttccaggagaagtggagcaggatgtaagcaccagcattccttcctgtatcccttttgtggcccagcctcctacctgtgaagtgaagccaaagcccagtgttaaaagaatggacaaacagacggaagagatacttggagatgaagttcaacttttttcacttgatgaagaatttgattatgacaatgtgatgctaacctccaagtttagtcctgcagagatagagaacatcaaagagctatgcaagcagcagaagagaaaggacaccagcccagacttagagaaatcctgtgactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: