Cart 8 Product Products 806,76 € (empty)
-
1 x UTP3-UTP3,...121,50 € -
-
-
-
1 x RNF11-ring...113,40 € -
-
-
No products
To be determined Shipping
806,76 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 8 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 806,76 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 806,76 €
View larger 
SLC25A16-solute carrier family 25 (mitochondrial carrier, Graves disease autoantigen), member 16 Gene
PTXBC001407
New product
Data sheet of SLC25A16-solute carrier family 25 (mitochondrial carrier, Graves disease autoantigen), member 16 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SLC25A16-solute carrier family 25 (mitochondrial carrier, Graves disease autoantigen), member 16 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001407 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SLC25A16 |
| Origin species: | Human |
| Product name: | SLC25A16-solute carrier family 25 (mitochondrial carrier, Graves disease autoantigen), member 16 Gene |
| Size: | 2ug |
| Accessions: | BC001407 |
| Gene id: | 8034 |
| Gene description: | solute carrier family 25 (mitochondrial carrier; Graves disease autoantigen), member 16 |
| Synonyms: | D10S105E; GDA; GDC; HGT.1; ML7; hML7; graves disease carrier protein; mitochondrial solute carrier protein homolog; solute carrier family 25 (mitochondrial carrier; Graves disease autoantigen), member 16; solute carrier family 25 member 16 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggcggcgacggccgcggcagccctggcggcggccgatccccctcccgcaatgccgcaggcggcaggggccggagggcccacaacccgcagagacttctactggctgcgctcctttctggccggaggtgggtccatgccacgaagagccagccgcgctctgagtggcgggggcaggactgtgggcaagtgggatgcaagcggcctctatgacattcctggactctggctgcttcaatgttctgttagatgtctgccctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - KH domain containing, RNA binding, signal transduction associated 3 - protein phosphatase 2 (formerly 2A), catalytic subunit, beta isoform - Fc fragment of IgE, high affinity I, receptor for; alpha polypeptide - glycine C-acetyltransferase (2-amino-3-ketobutyrate coenzyme A ligase) |