GNG11-guanine nucleotide binding protein (G protein), gamma 11 Gene View larger

GNG11-guanine nucleotide binding protein (G protein), gamma 11 Gene

PTXBC009709

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GNG11-guanine nucleotide binding protein (G protein), gamma 11 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GNG11-guanine nucleotide binding protein (G protein), gamma 11 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009709
Product type: DNA & cDNA
Ncbi symbol: GNG11
Origin species: Human
Product name: GNG11-guanine nucleotide binding protein (G protein), gamma 11 Gene
Size: 2ug
Accessions: BC009709
Gene id: 2791
Gene description: guanine nucleotide binding protein (G protein), gamma 11
Synonyms: GNGT11; guanine nucleotide-binding protein G(I)/G(S)/G(O) subunit gamma-11; G protein gamma-11 subunit; guanine nucleotide binding protein (G protein), gamma 11; guanine nucleotide-binding protein G(I)/G(S)/G(O) gamma-11 subunit; G protein subunit gamma 11
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcctgcccttcacatcgaagatttgccagagaaggaaaaactgaaaatggaagttgagcagcttcgcaaagaagtgaagttgcagagacaacaagtgtctaaatgttctgaagaaataaagaactatattgaagaacgttctggagaggatcctctagtaaagggaattccagaagacaagaacccctttaaagaaaaaggcagctgtgttatttcataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - G protein-coupled receptor, family C, group 5, member C
- coiled-coil-helix-coiled-coil-helix domain containing 4
- guanine nucleotide binding protein (G protein), alpha 14
- thioredoxin domain containing 4 (endoplasmic reticulum)

Buy GNG11-guanine nucleotide binding protein (G protein), gamma 11 Gene now

Add to cart