Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
GNG11-guanine nucleotide binding protein (G protein), gamma 11 Gene
PTXBC009709
New product
Data sheet of GNG11-guanine nucleotide binding protein (G protein), gamma 11 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GNG11-guanine nucleotide binding protein (G protein), gamma 11 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC009709 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GNG11 |
| Origin species: | Human |
| Product name: | GNG11-guanine nucleotide binding protein (G protein), gamma 11 Gene |
| Size: | 2ug |
| Accessions: | BC009709 |
| Gene id: | 2791 |
| Gene description: | guanine nucleotide binding protein (G protein), gamma 11 |
| Synonyms: | GNGT11; guanine nucleotide-binding protein G(I)/G(S)/G(O) subunit gamma-11; G protein gamma-11 subunit; guanine nucleotide binding protein (G protein), gamma 11; guanine nucleotide-binding protein G(I)/G(S)/G(O) gamma-11 subunit; G protein subunit gamma 11 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcctgcccttcacatcgaagatttgccagagaaggaaaaactgaaaatggaagttgagcagcttcgcaaagaagtgaagttgcagagacaacaagtgtctaaatgttctgaagaaataaagaactatattgaagaacgttctggagaggatcctctagtaaagggaattccagaagacaagaacccctttaaagaaaaaggcagctgtgttatttcataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - G protein-coupled receptor, family C, group 5, member C - coiled-coil-helix-coiled-coil-helix domain containing 4 - guanine nucleotide binding protein (G protein), alpha 14 - thioredoxin domain containing 4 (endoplasmic reticulum) |