Login to display prices
Login to display prices
TXNDC4-thioredoxin domain containing 4 (endoplasmic reticulum) Gene View larger

TXNDC4-thioredoxin domain containing 4 (endoplasmic reticulum) Gene

PTXBC005374

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TXNDC4-thioredoxin domain containing 4 (endoplasmic reticulum) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TXNDC4-thioredoxin domain containing 4 (endoplasmic reticulum) Gene

Proteogenix catalog: PTXBC005374
Ncbi symbol: TXNDC4
Product name: TXNDC4-thioredoxin domain containing 4 (endoplasmic reticulum) Gene
Size: 2ug
Accessions: BC005374
Gene id: 23071
Gene description: thioredoxin domain containing 4 (endoplasmic reticulum)
Synonyms: TXNDC4; PDIA10; endoplasmic reticulum resident protein 44; ER protein 44; endoplasmic reticulum resident protein 44 kDa; protein disulfide isomerase family A, member 10; thioredoxin domain containing 4 (endoplasmic reticulum); thioredoxin domain-containing protein 4; endoplasmic reticulum protein 44
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcatcctgccgtcttcctatccttacccgacctcagatgctcccttctgctcctggtaacttgggtttttactcctgtaacaactgaaataacaagtcttgatacagagaatatagatgaaattttaaacaatgctgatgttgctttagtaaatttttatgctgactggtgtcgtttcagtcagatgttgcatccaatttttgaggaagcttccgatgtcattaaggaagaatttccaaatgaaaatcaagtagtgtttgccagagttgattgtgatcagcactctgacatagcccagagatacaggataagcaaatacccaaccctcaaattgtttcgtaatgggatgatgatgaagagagaatacaggggtcagcgatcagtgaaagcattggcagattacatcaggcaacaaaaaagtgaccccattcaagaaattcgggacttagcagaaatcaccactcttgatcgcagcaaaagaaatatcattggatattttgagcaaaaggactcggacaactatagagtttttgaacgagtagcgaatattttgcatgatgactgtgcctttctttctgcatttggggatgtttcaaaaccggaaagatatagtggcgacaacataatctacaaaccaccagggcattctgctccggatatggtgtacttgggagctatgacaaattttgatgtgacttacaattggattcaagataaatgtgttcctcttgtccgagaaataacatttgaaaatggagaggaattgacagaagaaggactgccttttctcatactctttcacatgaaagaagatacagaaagtttagaaatattccagaatgaagtagctcggcaattaataagtgaaaaaggtacaataaactttttacatgccgattgtgacaaatttagacatcctcttctgcacatacagaaaactccagcagattgtcctgtaatcgctattgacagctttaggcatatgtatgtgtttggagacttcaaagatgtattaattcctggaaaactcaagcaattcgtatttgacttacattctggaaaactgcacagagaattccatcatggacctgacccaactgatacagccccaggagagcaagcccaagatgtagcaagcagtccacctgagagctccttccagaaactagcacccagtgaatataggtatactctattgagggatcgagatgagctttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: