TXNDC4-thioredoxin domain containing 4 (endoplasmic reticulum) Gene View larger

TXNDC4-thioredoxin domain containing 4 (endoplasmic reticulum) Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TXNDC4-thioredoxin domain containing 4 (endoplasmic reticulum) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TXNDC4-thioredoxin domain containing 4 (endoplasmic reticulum) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005374
Product type: DNA & cDNA
Ncbi symbol: TXNDC4
Origin species: Human
Product name: TXNDC4-thioredoxin domain containing 4 (endoplasmic reticulum) Gene
Size: 2ug
Accessions: BC005374
Gene id: 23071
Gene description: thioredoxin domain containing 4 (endoplasmic reticulum)
Synonyms: TXNDC4; PDIA10; endoplasmic reticulum resident protein 44; ER protein 44; endoplasmic reticulum resident protein 44 kDa; protein disulfide isomerase family A, member 10; thioredoxin domain containing 4 (endoplasmic reticulum); thioredoxin domain-containing protein 4; endoplasmic reticulum protein 44
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcatcctgccgtcttcctatccttacccgacctcagatgctcccttctgctcctggtaacttgggtttttactcctgtaacaactgaaataacaagtcttgatacagagaatatagatgaaattttaaacaatgctgatgttgctttagtaaatttttatgctgactggtgtcgtttcagtcagatgttgcatccaatttttgaggaagcttccgatgtcattaaggaagaatttccaaatgaaaatcaagtagtgtttgccagagttgattgtgatcagcactctgacatagcccagagatacaggataagcaaatacccaaccctcaaattgtttcgtaatgggatgatgatgaagagagaatacaggggtcagcgatcagtgaaagcattggcagattacatcaggcaacaaaaaagtgaccccattcaagaaattcgggacttagcagaaatcaccactcttgatcgcagcaaaagaaatatcattggatattttgagcaaaaggactcggacaactatagagtttttgaacgagtagcgaatattttgcatgatgactgtgcctttctttctgcatttggggatgtttcaaaaccggaaagatatagtggcgacaacataatctacaaaccaccagggcattctgctccggatatggtgtacttgggagctatgacaaattttgatgtgacttacaattggattcaagataaatgtgttcctcttgtccgagaaataacatttgaaaatggagaggaattgacagaagaaggactgccttttctcatactctttcacatgaaagaagatacagaaagtttagaaatattccagaatgaagtagctcggcaattaataagtgaaaaaggtacaataaactttttacatgccgattgtgacaaatttagacatcctcttctgcacatacagaaaactccagcagattgtcctgtaatcgctattgacagctttaggcatatgtatgtgtttggagacttcaaagatgtattaattcctggaaaactcaagcaattcgtatttgacttacattctggaaaactgcacagagaattccatcatggacctgacccaactgatacagccccaggagagcaagcccaagatgtagcaagcagtccacctgagagctccttccagaaactagcacccagtgaatataggtatactctattgagggatcgagatgagctttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - RNA binding motif, single stranded interacting protein 1
- GTPase activating protein (SH3 domain) binding protein 2
- general transcription factor IIIC, polypeptide 5, 63kDa
- ASF1 anti-silencing function 1 homolog A (S. cerevisiae)

Buy TXNDC4-thioredoxin domain containing 4 (endoplasmic reticulum) Gene now

Add to cart