G3BP2-GTPase activating protein (SH3 domain) binding protein 2 Gene View larger

G3BP2-GTPase activating protein (SH3 domain) binding protein 2 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of G3BP2-GTPase activating protein (SH3 domain) binding protein 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about G3BP2-GTPase activating protein (SH3 domain) binding protein 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC011731
Product type: DNA & cDNA
Ncbi symbol: G3BP2
Origin species: Human
Product name: G3BP2-GTPase activating protein (SH3 domain) binding protein 2 Gene
Size: 2ug
Accessions: BC011731
Gene id: 9908
Gene description: GTPase activating protein (SH3 domain) binding protein 2
Synonyms: ras GTPase-activating protein-binding protein 2; G3BP-2; GAP SH3 domain-binding protein 2; GTPase activating protein (SH3 domain) binding protein 2; Ras-GTPase activating protein SH3 domain-binding protein 2; G3BP stress granule assembly factor 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggttatggagaagcccagtccgctgcttgtagggcgggagtttgtgaggcaatattatactttgctgaataaagctccggaatatttacacaggttttatggcaggaattcttcctatgttcatggtggagtagatgctagtggaaagccccaggaagctgtttatggccaaaatgatatacaccacaaagtattatctctgaacttcagtgaatgtcatactaaaattcgtcatgtggatgctcatgcaaccttgagtgatggagtagttgtccaggtcatgggtttgctgtctaacagtggacaaccagaaagaaagtttatgcaaacctttgttctggctcctgaaggatctgttccaaataaattttatgttcacaatgatatgtttcgttatgaagatgaagtgtttggtgattctgagcctgaacttgatgaagaatcagaagatgaagtagaagaggaacaagaagaaagacaaccatctcctgaacctgtgcaagaaaatgctaacagtggttactatgaagctcaccctgtgactaatggcatagaggagcctttggaagaatcctctcatgaacctgaacctgagccagaatctgaaacaaagactgaagagctgaaaccacaagtggaggagaagaacttagaagaactagaggagaaatctactactcctcctccggcagaacctgtttctctgccacaagaaccaccaaagccaagagtcgaagctaaaccagaagttcaatctcagccacctcgtgtgcgtgaacaacgacctagagaacgacctggttttcctcctagaggaccaagaccaggcagaggagatatggaacagaatgactctgacaaccgtagaataattcgctatccagatagtcatcaactttttgttggtaacttgccacatgatattgatgaaaatgagctaaaggaattcttcatgagttttggaaacgttgtggaacttcgcatcaataccaagggtgttgggggaaagcttccaaattttggttttgtggtttttgatgactctgaaccagttcagagaatcttaattgcaaaaccgattatgtttcgaggggaagtacgtttaaatgtggaagagaaaaaaacaagagctgcaagagagcgagaaaccagaggtggtggtgatgatcgcagggatattaggcgcaatgatcgaggtcccggtggtccacgtggaattgtgggtggtggaatgatgcgtgatcgtgatggaagaggacctcctccaaggggtggcatggcacagaaacttggctctggaagaggaaccgggcaaatggagggccgcttcacaggacagcgtcgctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - general transcription factor IIIC, polypeptide 5, 63kDa
- ASF1 anti-silencing function 1 homolog A (S. cerevisiae)
- tubulin polymerization-promoting protein family member 2
- transforming growth factor, beta receptor II (70/80kDa)

Buy G3BP2-GTPase activating protein (SH3 domain) binding protein 2 Gene now

Add to cart