Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
TPPP2-tubulin polymerization-promoting protein family member 2 Gene
PTXBC038970
New product
Data sheet of TPPP2-tubulin polymerization-promoting protein family member 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TPPP2-tubulin polymerization-promoting protein family member 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC038970 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TPPP2 |
| Origin species: | Human |
| Product name: | TPPP2-tubulin polymerization-promoting protein family member 2 Gene |
| Size: | 2ug |
| Accessions: | BC038970 |
| Gene id: | 122664 |
| Gene description: | tubulin polymerization-promoting protein family member 2 |
| Synonyms: | C14orf8; CT152; P18; p25beta; tubulin polymerization-promoting protein family member 2; TPPP/p18; protein p25-beta; tubulin polymerization promoting protein family member 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcatcagaggcagaaaaaacattccatcggtttgctgcgtttggagaatcatcaagcagtggcactgaaatgaacaacaagaacttctccaagctgtgcaaagactgtggcatcatggatggcaagacagtcacctccacggacgtggacatcgtgttcagcaaagtcaaggccaagaacgcccgaaccatcacgtttcaacagttcaaagaggcagtgaaggaactgggccagaagcgcttcaaagggaagagtccagatgaagtcctggagaacatttatggactcatggagggcaaagacccagccaccactggcgctactaaagcaacaacagtgggtgcagtggaccgtttgacagacaccagcaagtacaccggcacccacaaggagctctttgatgagagtggcaagggcaagggcattgcgggacgggaagagatgactgacaacacaggctatgtgagtggttacaagggttctggcacctacgataagaagaccaagtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - transforming growth factor, beta receptor II (70/80kDa) - glutamate receptor, ionotropic, N-methyl D-aspartate 2C - coiled-coil-helix-coiled-coil-helix domain containing 2 - RNA (guanine-9-) methyltransferase domain containing 3 |