CHCHD2-coiled-coil-helix-coiled-coil-helix domain containing 2 Gene View larger

CHCHD2-coiled-coil-helix-coiled-coil-helix domain containing 2 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CHCHD2-coiled-coil-helix-coiled-coil-helix domain containing 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CHCHD2-coiled-coil-helix-coiled-coil-helix domain containing 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC066331
Product type: DNA & cDNA
Ncbi symbol: CHCHD2
Origin species: Human
Product name: CHCHD2-coiled-coil-helix-coiled-coil-helix domain containing 2 Gene
Size: 2ug
Accessions: BC066331
Gene id: 51142
Gene description: coiled-coil-helix-coiled-coil-helix domain containing 2
Synonyms: C7orf17; MNRR1; NS2TP; PARK22; coiled-coil-helix-coiled-coil-helix domain-containing protein 2; 16.7kD protein; HCV NS2 trans-regulated protein; aging-associated gene 10 protein; coiled-coil-helix-coiled-coil-helix domain-containing protein 2, mitochondrial; mitochondria nuclear retrograde regulator 1; coiled-coil-helix-coiled-coil-helix domain containing 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccgcgtggaagccgaagccgcacctcccgcatggcccctccggccagccgggcccctcagatgagagctgcacccaggccagcaccagtcgctcagccaccagcagcggcacccccatctgcagttggctcttctgctgctgcgccccggcagccagttctgatggcccagatggcaaccactgcagctggcgtggctgtgggctctgctgtggggcacacattgggtcacgccattactgggggcttcagtggaggaagtaatgctgagcctgcgaggcctgacatcacttaccaggagcctcagggaacccagccagcacagcagcagcagccttgcctctatgagatcaaacagtttctggagtgtgcccagaaccagggtgacatcaagctctgtgagggtttcaatgaggtgctgaaacagtgccgacttgcaaacggattggcctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - RNA (guanine-9-) methyltransferase domain containing 3
- GA binding protein transcription factor, beta subunit 1
- tumor necrosis factor receptor superfamily, member 1B
- cytochrome P450, family 27, subfamily A, polypeptide 1

Buy CHCHD2-coiled-coil-helix-coiled-coil-helix domain containing 2 Gene now

Add to cart