Login to display prices
Login to display prices
GABPB1-GA binding protein transcription factor, beta subunit 1 Gene View larger

GABPB1-GA binding protein transcription factor, beta subunit 1 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GABPB1-GA binding protein transcription factor, beta subunit 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about GABPB1-GA binding protein transcription factor, beta subunit 1 Gene

Proteogenix catalog: PTXBC050702
Ncbi symbol: GABPB1
Product name: GABPB1-GA binding protein transcription factor, beta subunit 1 Gene
Size: 2ug
Accessions: BC050702
Gene id: 2553
Gene description: GA binding protein transcription factor, beta subunit 1
Synonyms: BABPB2; E4TF1; E4TF1-47; E4TF1-53; E4TF1B; GABPB; GABPB-1; GABPB2; NRF2B1; NRF2B2; GA-binding protein subunit beta-1; GA binding protein transcription factor beta subunit 1 transcript variant gamma-2; GABP subunit beta-2; nuclear respiratory factor 2; transcription factor E4TF1-47; transcription factor E4TF1-53; GA binding protein transcription factor beta subunit 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtccctggtagatttgggaaagaagcttttagaagcggcacgagcaggtcaagatgatgaagttcgtattttgatggcaaatggagctccctttactacagactggctgggaacttctccacttcatctagcagcacagtatggtcattattccaccacagaggtactgctgcgagctggtgtgagcagagatgccagaaccaaagtggaccgaacaccattacatatggcagcttctgagggccatgccagcatagtagaggttttacttaagcatggtgctgatgtcaatgcaaaggacatgttaaagatgacagctctccattgggccacagaacacaatcatcaagaggtggtggaacttttaatcaaatatggtgctgatgtacacacgcaaagtaaattttgtaaaactgcatttgatatttcaatagacaatggaaatgaagatttagcagagatattacagattgctatgcagaaccaaatcaacacaaacccagagagtcctgacactgtgacaatacatgctgcaacaccacagtttatcattggacctggaggggtggtgaacctaacaggtctggtatcttcagaaaattcatccaaggcaacagatgaaacgggtgtatctgctgttcagtttggaaactcttctacatcagtattagctacattagctgccttagctgaagcatctgctccattgtccaattcttcagaaactccagtagtggccacagaagaagtagttactgcagaatctgtggatggtgccattcagcaagtagttagttcagggggtcagcaagtcatcacaatagttacagatggaattcagcttggaaatttgcactctattccaaccagtggaattggtcagcccatcattgtgaccatgccagatggacaacaagtattaacagtaccagcaacagacattgctgaagaaactgttataagtgaagaaccaccagctaagagacaatgtatcgaaataattgaaaaccgggtggaatctgcagaaatagaagagagagaagctcttcagaaacagctggatgaagcaaatcgagaagcacaaaaatatcgacagcagctcctaaagaaagaacaggaagcagaggcctacagacagaagttggaagctatgactcgtcttcagactaataaagaagctgtttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: