Cart 1 Product Products 113,40 € (empty)
-
1 x AK1-adenyl...113,40 €
No products
To be determined Shipping
113,40 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 113,40 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 113,40 €
View larger 
TNFRSF1B-tumor necrosis factor receptor superfamily, member 1B Gene
PTXBC052977
New product
Data sheet of TNFRSF1B-tumor necrosis factor receptor superfamily, member 1B Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TNFRSF1B-tumor necrosis factor receptor superfamily, member 1B Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC052977 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TNFRSF1B |
| Origin species: | Human |
| Product name: | TNFRSF1B-tumor necrosis factor receptor superfamily, member 1B Gene |
| Size: | 2ug |
| Accessions: | BC052977 |
| Gene id: | 7133 |
| Gene description: | tumor necrosis factor receptor superfamily, member 1B |
| Synonyms: | CD120b; TBPII; TNF-R-II; TNF-R75; TNFBR; TNFR1B; TNFR80; p75; p75TNFR; tumor necrosis factor receptor superfamily member 1B; TNF-R2; TNF-RII; p75 TNF receptor; p80 TNF-alpha receptor; soluble TNFR1B variant 1; tumor necrosis factor beta receptor; tumor necrosis factor binding protein 2; tumor necrosis factor receptor 2; tumor necrosis factor receptor type II; TNF receptor superfamily member 1B |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcgcccgtcgccgtctgggccgcgctggccgtcggactggagctctgggctgcggcgcacgccttgcccgcccaggtggcatttacaccctacgccccggagcccgggagcacatgccggctcagagaatactatgaccagacagctcagatgtgctgcagcaaatgctcgccgggccaacatgcaaaagtcttctgtaccaagacctcggacaccgtgtgtgactcctgtgaggacagcacatacacccagctctggaactgggttcccgagtgcttgagctgtggctcccgctgtagctctgaccaggtggaaactcaagcctgcactcgggaacagaaccgcatctgcacctgcaggcccggctggtactgcgcgctgagcaagcaggaggggtgccggctgtgcgcgccgctgcgcaagtgccgcccgggcttcggcgtggccagaccaggaactgaaacatcagacgtggtgtgcaagccctgtgccccggggacgttctccaacacgacttcatccacggatatttgcaggccccaccagatctgtaacgtggtggccatccctgggaatgcaagcatggatgcagtctgcacgtccacgtcccccacccggagtatggccccaggggcagtacacttaccccagccagtgtccacacgatcccaacacacgcagccaactccagaacccagcactgctccaagcacctccttcctgctcccaatgggccccagccccccagctgaagggagcactggcgacttcgctcttccagttggactgattgtgggtgtgacagccttgggtctactaataataggagtggtgaactgtgtcatcatgacccaggtgaaaaagaagcccttgtgcctgcagagagaagccaaggtgcctcacttgcctgccgataaggcccggggtacacagggccccgagcagcagcacctgctgatcacagcgccgagctccagcagcagctccctggagagctcggccagtgcgttggacagaagggcgcccactcggaaccagccacaggcaccaggcgtggaggccagtggggccggggaggcccgggccagcaccgggagctcagattcttcccctggtggccatgggacccaggtcaatgtcacctgcatcgtgaacgtctgtagcagctctgaccacagctcacagtgctcctcccaagccagctccacaatgggagacacagattccagcccctcggagtccccgaaggacgagcaggtccccttctccaaggaggaatgtgcctttcggtcacagctggagacgccagagaccctgctggggagcaccgaagagaagcccctgccccttggagtgcctgatgctgggatgaagcccagttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - cytochrome P450, family 27, subfamily A, polypeptide 1 - cytochrome c oxidase subunit VIb polypeptide 2 (testis) - mitogen-activated protein kinase kinase kinase kinase 2 - cytochrome P450, family 17, subfamily A, polypeptide 1 |