Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
GRIN2C-glutamate receptor, ionotropic, N-methyl D-aspartate 2C Gene
PTXBC059384
New product
Data sheet of GRIN2C-glutamate receptor, ionotropic, N-methyl D-aspartate 2C Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GRIN2C-glutamate receptor, ionotropic, N-methyl D-aspartate 2C Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC059384 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GRIN2C |
| Origin species: | Human |
| Product name: | GRIN2C-glutamate receptor, ionotropic, N-methyl D-aspartate 2C Gene |
| Size: | 2ug |
| Accessions: | BC059384 |
| Gene id: | 2905 |
| Gene description: | glutamate receptor, ionotropic, N-methyl D-aspartate 2C |
| Synonyms: | GluN2C; NMDAR2C; NR2C; glutamate receptor ionotropic, NMDA 2C; N-methyl D-aspartate receptor subtype 2C; N-methyl-D-aspartate receptor subunit 2C; glutamate [NMDA] receptor subunit epsilon-3; glutamate receptor, ionotropic, N-methyl D-aspartate 2C; glutamate ionotropic receptor NMDA type subunit 2C |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggtggggccctggggccggccctgttgctcacctcgctcttcggtgcctgggcagggctgggtccggggcagggcgagcagggcatgacggtggccgtggtgtttagcagctcagggccgccccaggcccagttccgtgcccgcctcaccccccagagcttcctggacctacccctggagatccagccgctcacagttggggtcaacaccaccaaccccagcagcctcctcacccagatctgcggcctcctgggtgctgcccacgtccacggcattgtctttgaggacaacgtggacaccgaggcggtggcccagatccttgacttcatctcctcccagacccatgtgcccatcctcagcatcagcggaggctctgctgtggtcctcacccccaaggtgcatgtccaaactcatgtcccctcgtgcctcaggcctggaaccaggctggggtcgggggtgctttggttctgggaagctgggattagacgggatgggcagggaggtgggggctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - coiled-coil-helix-coiled-coil-helix domain containing 2 - RNA (guanine-9-) methyltransferase domain containing 3 - GA binding protein transcription factor, beta subunit 1 - tumor necrosis factor receptor superfamily, member 1B |