Login to display prices
Login to display prices
GRIN2C-glutamate receptor, ionotropic, N-methyl D-aspartate 2C Gene View larger

GRIN2C-glutamate receptor, ionotropic, N-methyl D-aspartate 2C Gene

PTXBC059384

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GRIN2C-glutamate receptor, ionotropic, N-methyl D-aspartate 2C Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GRIN2C-glutamate receptor, ionotropic, N-methyl D-aspartate 2C Gene

Proteogenix catalog: PTXBC059384
Ncbi symbol: GRIN2C
Product name: GRIN2C-glutamate receptor, ionotropic, N-methyl D-aspartate 2C Gene
Size: 2ug
Accessions: BC059384
Gene id: 2905
Gene description: glutamate receptor, ionotropic, N-methyl D-aspartate 2C
Synonyms: GluN2C; NMDAR2C; NR2C; glutamate receptor ionotropic, NMDA 2C; N-methyl D-aspartate receptor subtype 2C; N-methyl-D-aspartate receptor subunit 2C; glutamate [NMDA] receptor subunit epsilon-3; glutamate receptor, ionotropic, N-methyl D-aspartate 2C; glutamate ionotropic receptor NMDA type subunit 2C
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggtggggccctggggccggccctgttgctcacctcgctcttcggtgcctgggcagggctgggtccggggcagggcgagcagggcatgacggtggccgtggtgtttagcagctcagggccgccccaggcccagttccgtgcccgcctcaccccccagagcttcctggacctacccctggagatccagccgctcacagttggggtcaacaccaccaaccccagcagcctcctcacccagatctgcggcctcctgggtgctgcccacgtccacggcattgtctttgaggacaacgtggacaccgaggcggtggcccagatccttgacttcatctcctcccagacccatgtgcccatcctcagcatcagcggaggctctgctgtggtcctcacccccaaggtgcatgtccaaactcatgtcccctcgtgcctcaggcctggaaccaggctggggtcgggggtgctttggttctgggaagctgggattagacgggatgggcagggaggtgggggctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: