GRIN2C-glutamate receptor, ionotropic, N-methyl D-aspartate 2C Gene View larger

GRIN2C-glutamate receptor, ionotropic, N-methyl D-aspartate 2C Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GRIN2C-glutamate receptor, ionotropic, N-methyl D-aspartate 2C Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about GRIN2C-glutamate receptor, ionotropic, N-methyl D-aspartate 2C Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC059384
Product type: DNA & cDNA
Ncbi symbol: GRIN2C
Origin species: Human
Product name: GRIN2C-glutamate receptor, ionotropic, N-methyl D-aspartate 2C Gene
Size: 2ug
Accessions: BC059384
Gene id: 2905
Gene description: glutamate receptor, ionotropic, N-methyl D-aspartate 2C
Synonyms: GluN2C; NMDAR2C; NR2C; glutamate receptor ionotropic, NMDA 2C; N-methyl D-aspartate receptor subtype 2C; N-methyl-D-aspartate receptor subunit 2C; glutamate [NMDA] receptor subunit epsilon-3; glutamate receptor, ionotropic, N-methyl D-aspartate 2C; glutamate ionotropic receptor NMDA type subunit 2C
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggtggggccctggggccggccctgttgctcacctcgctcttcggtgcctgggcagggctgggtccggggcagggcgagcagggcatgacggtggccgtggtgtttagcagctcagggccgccccaggcccagttccgtgcccgcctcaccccccagagcttcctggacctacccctggagatccagccgctcacagttggggtcaacaccaccaaccccagcagcctcctcacccagatctgcggcctcctgggtgctgcccacgtccacggcattgtctttgaggacaacgtggacaccgaggcggtggcccagatccttgacttcatctcctcccagacccatgtgcccatcctcagcatcagcggaggctctgctgtggtcctcacccccaaggtgcatgtccaaactcatgtcccctcgtgcctcaggcctggaaccaggctggggtcgggggtgctttggttctgggaagctgggattagacgggatgggcagggaggtgggggctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - coiled-coil-helix-coiled-coil-helix domain containing 2
- RNA (guanine-9-) methyltransferase domain containing 3
- GA binding protein transcription factor, beta subunit 1
- tumor necrosis factor receptor superfamily, member 1B

Buy GRIN2C-glutamate receptor, ionotropic, N-methyl D-aspartate 2C Gene now

Add to cart