CHCHD4-coiled-coil-helix-coiled-coil-helix domain containing 4 Gene View larger

CHCHD4-coiled-coil-helix-coiled-coil-helix domain containing 4 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CHCHD4-coiled-coil-helix-coiled-coil-helix domain containing 4 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CHCHD4-coiled-coil-helix-coiled-coil-helix domain containing 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC017082
Product type: DNA & cDNA
Ncbi symbol: CHCHD4
Origin species: Human
Product name: CHCHD4-coiled-coil-helix-coiled-coil-helix domain containing 4 Gene
Size: 2ug
Accessions: BC017082
Gene id: 131474
Gene description: coiled-coil-helix-coiled-coil-helix domain containing 4
Synonyms: TIMM40; mitochondrial intermembrane space import and assembly protein 40; coiled-coil-helix-coiled-coil-helix domain-containing protein 4; mitochondrial intermembrane space import and assembly 40 homolog; translocase of inner mitochondrial membrane 40 homolog; coiled-coil-helix-coiled-coil-helix domain containing 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcctattgccggcaggaagggaaggatcgaatcatatttgtaaccaaagaagatcatgaaactccaagcagtgcagaattggtggctgatgaccccaacgatccatacgaggagcatggattgatactgccaaatggaaacattaactggaactgcccatgccttgggggaatggccagcggtccctgtggagaacagtttaagtcagccttttcctgcttccactatagcacggaggagatcaaggggtcagactgtgtagaccagttccgggccatgcaggaatgcatgcagaaatacccagacctctatccccaagaggatgaggatgaggaagaggaaagagagaagaagccagcagaacaagcagaagaaacagctcccattgaggccactgcaaccaaagaagaggagggatcaagttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - guanine nucleotide binding protein (G protein), alpha 14
- thioredoxin domain containing 4 (endoplasmic reticulum)
- RNA binding motif, single stranded interacting protein 1
- GTPase activating protein (SH3 domain) binding protein 2

Buy CHCHD4-coiled-coil-helix-coiled-coil-helix domain containing 4 Gene now

Add to cart