GNA14-guanine nucleotide binding protein (G protein), alpha 14 Gene View larger

GNA14-guanine nucleotide binding protein (G protein), alpha 14 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GNA14-guanine nucleotide binding protein (G protein), alpha 14 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about GNA14-guanine nucleotide binding protein (G protein), alpha 14 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC027886
Product type: DNA & cDNA
Ncbi symbol: GNA14
Origin species: Human
Product name: GNA14-guanine nucleotide binding protein (G protein), alpha 14 Gene
Size: 2ug
Accessions: BC027886
Gene id: 9630
Gene description: guanine nucleotide binding protein (G protein), alpha 14
Synonyms: guanine nucleotide-binding protein subunit alpha-14; g alpha-14; guanine nucleotide binding protein (G protein), alpha 14; guanine nucleotide-binding protein 14; G protein subunit alpha 14
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccggctgctgctgcctgtccgcggaggagaaggagtcgcagcgcatcagcgcggagatcgagcgacagcttcgtcgggacaagaaggacgcgcgccgtgagcttaagctgctgctgctgggaactggtgaaagtgggaaaagcacctttatcaagcagatgagaattatccatgggtctggttacagcgacgaagacagaaaggggttcacgaagctggtttaccaaaacatattcaccgccatgcaagccatgatcagagcgatggacacgctaaggatacagtatgtgtgtgaacagaataaggaaaatgcccagataatcagagaagtggaagtggacaaggtctccatgctctccagggagcaggtggaggccatcaagcagctctggcaagatccaggcatccaggagtgttacgacaggaggagggagtaccagctgtcggactctgccaaatattacctgactgacattgaccgcatcgccacaccatcattcgtgcctacccaacaagatgtgcttcgcgtccgagtgcccaccaccggcatcattgagtatccatttgacttggaaaacatcatctttcggatggtggatgttggtggccaacgatcggaaagacggaagtggattcactgctttgagagtgtcacctccattattttcttggttgctctgagtgaatatgaccaggtcctggctgagtgtgacaacgagaatcgcatggaagagagcaaagccttatttaaaaccatcatcacctacccctggtttctgaattcgtctgtgattttattcttgaacaagaaggatcttttggaagagaaaatcatgtactctcatctaattagctatttcccagaatacacaggaccgaaacaggatgtcagagctgccagagactttatcctgaagctttaccaagatcagaatcctgacaaagagaaagtcatctactctcacttcacatgtgctacagatacagacaatattcgctttgtgtttgctgctgtcaaagacacaattctacagctaaacctaagggaattcaaccttgtctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - thioredoxin domain containing 4 (endoplasmic reticulum)
- RNA binding motif, single stranded interacting protein 1
- GTPase activating protein (SH3 domain) binding protein 2
- general transcription factor IIIC, polypeptide 5, 63kDa

Buy GNA14-guanine nucleotide binding protein (G protein), alpha 14 Gene now

Add to cart