Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
GPRC5C-G protein-coupled receptor, family C, group 5, member C Gene
PTXBC004925
New product
Data sheet of GPRC5C-G protein-coupled receptor, family C, group 5, member C Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GPRC5C-G protein-coupled receptor, family C, group 5, member C Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC004925 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GPRC5C |
| Origin species: | Human |
| Product name: | GPRC5C-G protein-coupled receptor, family C, group 5, member C Gene |
| Size: | 2ug |
| Accessions: | BC004925 |
| Gene id: | 55890 |
| Gene description: | G protein-coupled receptor, family C, group 5, member C |
| Synonyms: | RAIG-3; RAIG3; G-protein coupled receptor family C group 5 member C; orphan G-protein coupled receptor; retinoic acid responsive gene protein; retinoic acid-induced gene 3 protein; G protein-coupled receptor class C group 5 member C |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccatccacaaagccttggtgatgtgcctgggactgcctctcttcctgttcccaggggcctgggcccagggccatgtcccacccggctgcagccaaggcctcaaccccctgtactacaacctgtgtgaccgctctggggcgtggggcatcgtcctggaggccgtggctggggcgggcattgtcaccacgtttgtgctcaccatcatcctggtggccagcctcccctttgtgcaggacaccaagaaacggagcctgctggggacccagctaagaggccggtgtcaccatacagcgggtacaatgggcagctgctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - coiled-coil-helix-coiled-coil-helix domain containing 4 - guanine nucleotide binding protein (G protein), alpha 14 - thioredoxin domain containing 4 (endoplasmic reticulum) - RNA binding motif, single stranded interacting protein 1 |