C8orf51-chromosome 8 open reading frame 51 Gene View larger

C8orf51-chromosome 8 open reading frame 51 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C8orf51-chromosome 8 open reading frame 51 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C8orf51-chromosome 8 open reading frame 51 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000203
Product type: DNA & cDNA
Ncbi symbol: C8orf51
Origin species: Human
Product name: C8orf51-chromosome 8 open reading frame 51 Gene
Size: 2ug
Accessions: BC000203
Gene id: 78998
Gene description: chromosome 8 open reading frame 51
Synonyms: C8orf51; RHPN1 antisense RNA 1 (head to head)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcctgctttcttctctctgcccgcggagcggaggctccaggcctggccccagtccgaggcgcctctgtcggtgtcgtcctgcttccaaaaccggcctccagaacccgcctccttccagaacctccgtccagaacccgcctccctccagaacctccgtacagaacccacatccttctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - Down syndrome critical region gene 8
- chromosome 8 open reading frame 59
- mitochondrial ribosomal protein L34
- chromosome 9 open reading frame 97

Buy C8orf51-chromosome 8 open reading frame 51 Gene now

Add to cart