MRPL34-mitochondrial ribosomal protein L34 Gene View larger

MRPL34-mitochondrial ribosomal protein L34 Gene

PTXBC000071

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MRPL34-mitochondrial ribosomal protein L34 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MRPL34-mitochondrial ribosomal protein L34 Gene

Proteogenix catalog: PTXBC000071
Ncbi symbol: MRPL34
Product name: MRPL34-mitochondrial ribosomal protein L34 Gene
Size: 2ug
Accessions: BC000071
Gene id: 64981
Gene description: mitochondrial ribosomal protein L34
Synonyms: L34mt; 39S ribosomal protein L34, mitochondrial; MRP-L34; mitochondrial ribosomal protein L34
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgtcttggctggatccctgttgggccccacgagtaggtcggcagcgttgctgggtggcaggtggctccagccccgggcctggctggggttcccagacgcctggggcctccccaccccgcagcaggcccggggcaaggctcgcgggaatgagtatcagccgagcaacatcaaacgcaagaacaagcacggctgggtccggcgcctgagcacgccggccggcgtgcaggtcatccttcgccgaatgctcaagggccgcaagtcgctgagccattga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

Buy MRPL34-mitochondrial ribosomal protein L34 Gene now

Add to cart