No products
Prices are tax excluded
PTXBC017213
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC017213 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RP6-213H19.1 |
| Origin species: | Human |
| Product name: | RP6-213H19.1-serine/threonine protein kinase MST4 Gene |
| Size: | 2ug |
| Accessions: | BC017213 |
| Gene id: | 51765 |
| Gene description: | serine/threonine protein kinase MST4 |
| Synonyms: | MASK; serine/threonine-protein kinase 26; Mst3 and SOK1-related kinase; STE20-like kinase 4; STE20-like kinase MST4; mammalian Ste20-like protein kinase 4; mammalian sterile 20-like 4; serine/threonine protein kinase MST4; serine/threonine-protein kinase MASK; serine/threonine protein kinase 26 |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcccactcgccggtggctgtccaagtgcctgggatgcagaataacatagctgatccagaagaactgttcacaaaattagagcgcattgggaaaggctcatttggggaagttttcaaaggaattgataaccgtacccagcaagtcgttgctattaaaatcatagaccttgaggaagccgaagatgaaatagaagacattcagcaagaaataactgtcttgagtcaatgtgacagctcatatgtaacaaaatactatgggtcatatttaaaggggtctaaattatggataataatggaatacctgggcggtggttcagcactggatcttcttcgagctttaccaccgtacgaaagaagcctgatccaaagaaagtacagaatggggcagagcaagatcttgtgcaaaccctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - ubiquitin-conjugating enzyme E2W (putative) - angiotensin II receptor-associated protein - ubiquitin-conjugating enzyme E2W (putative) - UEV and lactate/malate dehyrogenase domains |