Login to display prices
Login to display prices
UBE2W-ubiquitin-conjugating enzyme E2W (putative) Gene View larger

UBE2W-ubiquitin-conjugating enzyme E2W (putative) Gene

PTXBC010900

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of UBE2W-ubiquitin-conjugating enzyme E2W (putative) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about UBE2W-ubiquitin-conjugating enzyme E2W (putative) Gene

Proteogenix catalog: PTXBC010900
Ncbi symbol: UBE2W
Product name: UBE2W-ubiquitin-conjugating enzyme E2W (putative) Gene
Size: 2ug
Accessions: BC010900
Gene id: 55284
Gene description: ubiquitin-conjugating enzyme E2W (putative)
Synonyms: UBC-16; UBC16; ubiquitin-conjugating enzyme E2 W; E2 ubiquitin-conjugating enzyme W; N-terminal E2 ubiquitin-conjugating enzyme; N-terminus-conjugating E2; ubiquitin carrier protein W; ubiquitin conjugating enzyme E2W (putative); ubiquitin-conjugating enzyme 16; ubiquitin-conjugating enzyme 2W; ubiquitin-protein ligase W; ubiquitin conjugating enzyme E2 W (putative)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgtcaatgcagaaacgactacagaaagaactgttggctttgcaaaatgacccatctcctggaatgaccttaaatgagaagagtgctcaaaattcaattacacagtggattgtagacatggaaagtgcaccaggtaccttatatgaaggggaaaaatttcaacttctatttaaatttagtagtcgatatccttttgactctcctcaggtcatgtttactggtgaaaatattcctgttcatcctcatgtttatagcaatggtcatatctgtttatccattctaacagaagactggtccccagcgctctcagtccaatcagtttgtcttagcattattagcatgctttccagctgcaaggaaaagagacgaccaccggataattctttttatgtgcgaacatgtaacaagaatccaaagaaaacaaaatggtggtatcatgaactgaaatctgccttcatactatctattacggattga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice