Login to display prices
Login to display prices
WAC-WW domain containing adaptor with coiled-coil Gene View larger

WAC-WW domain containing adaptor with coiled-coil Gene

PTXBC010356

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of WAC-WW domain containing adaptor with coiled-coil Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about WAC-WW domain containing adaptor with coiled-coil Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC010356
Product type: DNA & cDNA
Ncbi symbol: WAC
Origin species: Human
Product name: WAC-WW domain containing adaptor with coiled-coil Gene
Size: 2ug
Accessions: BC010356
Gene id: 51322
Gene description: WW domain containing adaptor with coiled-coil
Synonyms: BM-016; DESSH; PRO1741; Wwp4; WW domain-containing adapter protein with coiled-coil; WW domain containing adaptor with coiled-coil
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtctttaacatctgatgcgtcatccccaagatcatatgtttctccaagaataagcacacctcaaactaacacagtccctatcaaacctttgatcagtactcctcctgtttcatcacagccaaaggttagtactccagtagttaagcaaggaccagtgtcacagtcagccacacagcagcctgtaactgctgacaagcagcaaggtcatgaacctgtctctcctcgaagtcttcagcgctcaagtagccagagaagtccatcacctggtcccaatcatacttctaatagtagtaatgcatcaaatgcaacagttgtaccacagaattcttctgcccgatccacgtgttcattaacgcctgcactagcagcacacttcagtgaaaatctcataaaacacgttcaaggatggcctgcagatcatgcagagaggcaggcatcaagattacgcgaagaagcgcataacatgggaactattcacatgtccgaaatttgtactgaattaaaaaatttaagatctttagtccgagtatgtgaaattcaagcaactttgcgagagcaaaggatactatttttgagacaacaaattaaggaacttgaaaagctaaaaaatcagaattccttcatggtgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - fibroblast growth factor binding protein 1
- serine peptidase inhibitor, Kunitz type, 2
- alanyl-tRNA synthetase domain containing 1
- actin binding LIM protein family, member 3