Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of FGFBP1-fibroblast growth factor binding protein 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FGFBP1-fibroblast growth factor binding protein 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC008910 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FGFBP1 |
| Origin species: | Human |
| Product name: | FGFBP1-fibroblast growth factor binding protein 1 Gene |
| Size: | 2ug |
| Accessions: | BC008910 |
| Gene id: | 9982 |
| Gene description: | fibroblast growth factor binding protein 1 |
| Synonyms: | FGF-BP; FGF-BP1; FGFBP; FGFBP-1; HBP17; fibroblast growth factor-binding protein 1; 17 kDa HBGF-binding protein; 17 kDa heparin-binding growth factor-binding protein; FGF-binding protein 1; heparin-binding growth factor binding protein; fibroblast growth factor binding protein 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaagatctgtagcctcaccctgctctccttcctcctactggctgctcaggtgctcctggtggagggaaaaaaaaaagtgaagaatggacttcacagcaaagtggtctcagaacaaaaggacactctgggcaacacccagattaagcagaaaagcaggcccgggaacaaaggcaagtttgtcaccaaagaccaagccaactgcagatgggctgctactgagcaggaggagggcatctctctcaaggttgagtgcactcaattggaccatgaattttcctgtgtctttgctggcaatccaacctcatgcctaaagctcaaggatgagagagtctattggaaacaagttgcccggaatctgcgctcacagaaagacatctgtagatattccaagacagctgtgaaaaccagagtgtgcagaaaggattttccagaatccagtcttaagctagtcagctccactctatttgggaacacaaagcccaggaaggagaaaacagagatgtcccccagggagcacatcaagggcaaagagaccaccccctctagcctagcagtgacccagaccatggccaccaaagctcccgagtgtgtggaggacccagatatggcaaaccagaggaagactgccctggagttctgtggagagacttggagctctctctgcacattcttcctcagcatagtgcaggacacgtcatgctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - serine peptidase inhibitor, Kunitz type, 2 - alanyl-tRNA synthetase domain containing 1 - actin binding LIM protein family, member 3 - putative homeodomain transcription factor 1 |