SPINT2-serine peptidase inhibitor, Kunitz type, 2 Gene View larger

SPINT2-serine peptidase inhibitor, Kunitz type, 2 Gene

PTXBC001668

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SPINT2-serine peptidase inhibitor, Kunitz type, 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SPINT2-serine peptidase inhibitor, Kunitz type, 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001668
Product type: DNA & cDNA
Ncbi symbol: SPINT2
Origin species: Human
Product name: SPINT2-serine peptidase inhibitor, Kunitz type, 2 Gene
Size: 2ug
Accessions: BC001668
Gene id: 10653
Gene description: serine peptidase inhibitor, Kunitz type, 2
Synonyms: DIAR3; HAI-2; HAI2; Kop; kunitz-type protease inhibitor 2; hepatocyte growth factor activator inhibitor type 2; placental bikunin; serine protease inhibitor, Kunitz type, 2; testicular tissue protein Li 183; serine peptidase inhibitor, Kunitz type 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgcagctgtgcgggctgaggcggagccgggcgtttctcgccctgctgggatcgctgctcctctctggggtcctggcggccgaccgagaacgcagcatccacgacttctgcctggtgtcgaaggtggtgggcagatgccgggcctccatgcctaggtggtggtacaatgtcactgacggatcctgccagctgtttgtgtatgggggctgtgacggaaacagcaataattacctgaccaaggaggagtgcctcaagaaatgtgccactgtcacagagaatgccacgggtgacctggccaccagcaggaatgcagcggattcctctgtcccaagtgctcccagaaggcaggattctgaagaccactccagcgatatgttcaactatgaagaatactgcaccgccaacgcagtcactgggccttgccgtgcatccttcccacgctggtactttgacgtggagaggaactcctgcaataacttcatctatggaggctgccggggcaataagaacagctaccgctctgaggaggcctgcatgctccgctgcttccgccagcaggagaatcctcccctgccccttggctcaaaggtggtggttctggcggggctgttcgtgatggtgttgatcctcttcctgggagcctccatggtctacctgatccgggtggcacggaggaaccaggagcgtgccctgcgcaccgtctggagctccggagatgacaaggagcagctggtgaagaacacatatgtcctgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - alanyl-tRNA synthetase domain containing 1
- actin binding LIM protein family, member 3
- putative homeodomain transcription factor 1
- calcium binding and coiled-coil domain 1

Buy SPINT2-serine peptidase inhibitor, Kunitz type, 2 Gene now

Add to cart