Login to display prices
Login to display prices
SPINT2-serine peptidase inhibitor, Kunitz type, 2 Gene View larger

SPINT2-serine peptidase inhibitor, Kunitz type, 2 Gene

PTXBC001668

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SPINT2-serine peptidase inhibitor, Kunitz type, 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SPINT2-serine peptidase inhibitor, Kunitz type, 2 Gene

Proteogenix catalog: PTXBC001668
Ncbi symbol: SPINT2
Product name: SPINT2-serine peptidase inhibitor, Kunitz type, 2 Gene
Size: 2ug
Accessions: BC001668
Gene id: 10653
Gene description: serine peptidase inhibitor, Kunitz type, 2
Synonyms: DIAR3; HAI-2; HAI2; Kop; kunitz-type protease inhibitor 2; hepatocyte growth factor activator inhibitor type 2; placental bikunin; serine protease inhibitor, Kunitz type, 2; testicular tissue protein Li 183; serine peptidase inhibitor, Kunitz type 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgcagctgtgcgggctgaggcggagccgggcgtttctcgccctgctgggatcgctgctcctctctggggtcctggcggccgaccgagaacgcagcatccacgacttctgcctggtgtcgaaggtggtgggcagatgccgggcctccatgcctaggtggtggtacaatgtcactgacggatcctgccagctgtttgtgtatgggggctgtgacggaaacagcaataattacctgaccaaggaggagtgcctcaagaaatgtgccactgtcacagagaatgccacgggtgacctggccaccagcaggaatgcagcggattcctctgtcccaagtgctcccagaaggcaggattctgaagaccactccagcgatatgttcaactatgaagaatactgcaccgccaacgcagtcactgggccttgccgtgcatccttcccacgctggtactttgacgtggagaggaactcctgcaataacttcatctatggaggctgccggggcaataagaacagctaccgctctgaggaggcctgcatgctccgctgcttccgccagcaggagaatcctcccctgccccttggctcaaaggtggtggttctggcggggctgttcgtgatggtgttgatcctcttcctgggagcctccatggtctacctgatccgggtggcacggaggaaccaggagcgtgccctgcgcaccgtctggagctccggagatgacaaggagcagctggtgaagaacacatatgtcctgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: